We narrowed to 31,856 results for: ica
-
Plasmid#239804PurposeExpress mRFP1 in filamentous fungiDepositorInsertmRFP1
UseFungal expressionPromoterTef1INAvailable SinceAug. 25, 2025AvailabilityAcademic Institutions and Nonprofits only -
pGY219
Plasmid#239806PurposeExpress H2B-EGFP in filamentous fungiDepositorInsertH2B
UseFungal expressionTagsEGFPPromoterTef1INAvailable SinceAug. 25, 2025AvailabilityAcademic Institutions and Nonprofits only -
pGY220
Plasmid#239807PurposeExpress H3-EGFP in filamentous fungiDepositorInsertH3
UseFungal expressionTagsEGFPPromoterTef1INAvailable SinceAug. 25, 2025AvailabilityAcademic Institutions and Nonprofits only -
pGY224
Plasmid#239808PurposeExpress H2B-mRFP1 in filamentous fungiDepositorInsertH2B
UseFungal expressionTagsmRFP1PromoterTef1INAvailable SinceAug. 25, 2025AvailabilityAcademic Institutions and Nonprofits only -
pGY225
Plasmid#239809PurposeExpress H3-mRFP1 in filamentous fungiDepositorInsertH3
UseFungal expressionTagsmRFP1PromoterTef1INAvailable SinceAug. 25, 2025AvailabilityAcademic Institutions and Nonprofits only -
pGY232
Plasmid#239810PurposeExpress EGFP-P2A-mRFP1 in filamentous fungiDepositorInsertsEGFP
mRFP1
UseFungal expressionTags2APromoterTef1INAvailable SinceAug. 25, 2025AvailabilityAcademic Institutions and Nonprofits only -
pNA-Y
Plasmid#238993PurposeNode A carrying sgRNA-1 that can be used for the assembly of pEND-Y11DepositorInsertsgRNA-1
UseSynthetic BiologyExpressionBacterialMutationWTAvailable SinceAug. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
AAVTRE3_smFP_HA
Plasmid#201209PurposeAAV vector for TRE(TRE3G)-driven smFP_HA (HA-tagged spaghetti monster) expressionDepositorInsertsmFP _HA (addgene plasmid #59759)
UseAAVExpressionBacterial and MammalianPromoterTRE3GAvailable SinceAug. 14, 2025AvailabilityAcademic Institutions and Nonprofits only -
CMV-RMP64-FLAG (pAVA3889)
Plasmid#239232PurposeExpresses C-FLAG tagged Rmp64 (CMV-RMP64-FLAG)DepositorInsertRMP64-FLAG
TagsFLAGExpressionMammalianAvailable SinceAug. 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
CMV-RMP24-FLAG (pAVA3890)
Plasmid#239234PurposeExpresses C-FLAG tagged Rmp24 (CMV-RMP24-FLAG)DepositorInsertRMP24-FLAG
TagsFLAGExpressionMammalianAvailable SinceAug. 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
CMV-RPP21-FLAG (pAVA3892)
Plasmid#239235PurposeExpresses C-FLAG tagged Rpp21 (CMV-RPP21-FLAG)DepositorInsertRPP21-FLAG
TagsFLAGExpressionMammalianAvailable SinceAug. 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
CMV-RPP25-FLAG (pAVA3895)
Plasmid#239236PurposeExpresses C-FLAG tagged Rpp25 (CMV-RPP25-FLAG)DepositorInsertRPP25-FLAG
TagsFLAGExpressionMammalianAvailable SinceAug. 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
pEND-Z11
Plasmid#239001PurposeFinal circuit with -Ara: ON, +Ara: ON behaviourDepositorInsertCircuit with sfGFP expression (-Ara: ON, +Ara: ON)
UseSynthetic BiologyExpressionBacterialMutationWTAvailable SinceJuly 22, 2025AvailabilityAcademic Institutions and Nonprofits only -
POC1426
Plasmid#221573PurposePlasmid containing the Insert 1 to be assembled in POC1430 using the site-selective methylation protection approachDepositorInsertDNA fragment flanked by methylation-protectable BsaI sites and containing one always-methylable internal BsaI site
UseSynthetic BiologyAvailable SinceJune 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
POC1427
Plasmid#221574PurposePlasmid containing the Insert 2 to be assembled in POC1430 using the site-selective methylation protection approachDepositorInsertDNA fragment flanked by methylation-protectable BsaI sites and containing one always-methylable internal BsaI site
UseSynthetic BiologyAvailable SinceJune 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
POC1428
Plasmid#221575PurposePlasmid containing the Insert 3 to be assembled in POC1430 using the site-selective methylation protection approachDepositorInsertDNA fragment flanked by methylation-protectable BsaI sites and containing one always-methylable internal BsaI site
UseSynthetic BiologyAvailable SinceJune 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
POC1429
Plasmid#221576PurposePlasmid containing the Insert 4 to be assembled in POC1430 using the site-selective methylation protection approachDepositorInsertDNA fragment flanked by methylation-protectable BsaI sites and containing one always-methylable internal BsaI site
UseSynthetic BiologyAvailable SinceJune 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pSEVA63_sgRNA-B0_M13ps
Plasmid#231421PurposeM13 phagemid constitutively expressing sgRNA-B0. sgRNA-B0 is a dummy 20-nt sequence, containing a Golden Gate cloning site (BsaI). (A gift of the Jaramillo Lab, where it is called PAJ552.)DepositorInsertsgRNA-B0
UseSynthetic BiologyAvailable SinceJune 9, 2025AvailabilityAcademic Institutions and Nonprofits only -
P-Bf-fusA2
Plasmid#235658PurposeReports Cur activity in Bacteroides fragilisDepositorInsertBacteroides fragilis fusA2 promoter
MutationThe B. thetaiotaomicron fusA2 promoter lacking &q…Available SinceJune 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
pHK401
Plasmid#235482PurposeRepression of gene VIII by Plux/tet hybrid promoterDepositorInsertphage M13 geneVIII, cI repressor
ExpressionBacterialAvailable SinceMay 27, 2025AvailabilityAcademic Institutions and Nonprofits only -
pHK201
Plasmid#235481PurposeRepression of gene VIII by Ptac promoterDepositorInsertphage M13 geneVIII, cI repressor
ExpressionBacterialAvailable SinceMay 27, 2025AvailabilityAcademic Institutions and Nonprofits only -
pHK328
Plasmid#235479PurposeInducible gene VIII by Pbad/lac hybrid promoterDepositorInsertphage M13 geneVIII
ExpressionBacterialAvailable SinceMay 27, 2025AvailabilityAcademic Institutions and Nonprofits only -
pHK318
Plasmid#235478PurposeInducible gene VIII by Plux/tet hybrid promoterDepositorInsertphage M13 geneVIII
ExpressionBacterialAvailable SinceMay 27, 2025AvailabilityAcademic Institutions and Nonprofits only -
pHK009
Plasmid#235459PurposeNOR gate receiver with bs for sgRNA2 and sgRNA3DepositorInsertNOR gate
UseSynthetic BiologyAvailable SinceMay 27, 2025AvailabilityAcademic Institutions and Nonprofits only -
BtARR2 long (1-393)
Plasmid#236270PurposeBacterial expression of bovine arrestin-2 long isoform (1-393) Q394StopDepositorAvailable SinceMay 22, 2025AvailabilityAcademic Institutions and Nonprofits only -
BtARR2 long (1-382)
Plasmid#236269PurposeBacterial expression of bovine arrestin-2 long isoform (1-382) D383StopDepositorAvailable SinceMay 22, 2025AvailabilityAcademic Institutions and Nonprofits only -
pHK506.4
Plasmid#235455PurposeBUF/YES gate receiver with bs for sgRNA2DepositorInsertYES/BUF gate
UseSynthetic BiologyAvailable SinceMay 19, 2025AvailabilityAcademic Institutions and Nonprofits only -
pHK506.5
Plasmid#235456PurposeBUF/YES gate receiver with bs for sgRNA3DepositorInsertYES/BUF gate
UseSynthetic BiologyAvailable SinceMay 19, 2025AvailabilityAcademic Institutions and Nonprofits only -
pHK507
Plasmid#235457PurposeOR/NAND gate receiver with bs for sgRNA2 and sgRNA3DepositorInsertOR gate
UseSynthetic BiologyAvailable SinceMay 19, 2025AvailabilityAcademic Institutions and Nonprofits only -
BtARR2 short
Plasmid#236267PurposeBacterial expression of bovine arrestin-2 short isoformDepositorAvailable SinceMay 12, 2025AvailabilityAcademic Institutions and Nonprofits only -
pHK346
Plasmid#235477PurposeInducible gene VIII by Pbad promoterDepositorInsertphage M13 geneVIII
ExpressionBacterialAvailable SinceMay 9, 2025AvailabilityAcademic Institutions and Nonprofits only -
pHK336
Plasmid#235476PurposeInducible gene VIII by Plux promoterDepositorInsertphage M13 geneVIII
ExpressionBacterialAvailable SinceMay 9, 2025AvailabilityAcademic Institutions and Nonprofits only -
pHK-cinI
Plasmid#235486PurposeInducible gene cinI for OC14-HSL production by Ptac promoterDepositorInsertcinI
ExpressionBacterialAvailable SinceMay 9, 2025AvailabilityAcademic Institutions and Nonprofits only -
ADEPT-pTarget-tetR
Plasmid#238043PurposeModified ADEPT-pCas9 with sfGFP under TtrB promoter for tetrathionate (TTR) sensing.DepositorInsertsfGFP
UseSynthetic BiologyPromoterttrBAvailable SinceMay 6, 2025AvailabilityAcademic Institutions and Nonprofits only -
REV7 C-terminal sgRNA
Plasmid#207095PurposepX330 based plasmid for expression of Cas9 and the GCTCATAAAGGCAGCTGAGG sgRNA to target the REV7 locus.DepositorInsertGCTCATAAAGGCAGCTGAGG
ExpressionMammalianPromoterCMV and U6Available SinceMay 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
pHK001.3QS
Plasmid#235485Purposeinducible NOT gate receiver with bs for sgRNA3DepositorInsertNOT gate
UseSynthetic BiologyAvailable SinceApril 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
pHK302.6
Plasmid#235471PurposeMessage phagemid carrying sgRNA6 (prom. J23110, backbone pBR322)DepositorInsertsgRNA6
UseSynthetic BiologyAvailable SinceApril 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
pHK052.3
Plasmid#235472PurposeMessage phagemid carrying sgRNA3 (prom. J23119, backbone RSF1030)DepositorInsertsgRNA3
UseSynthetic BiologyAvailable SinceApril 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
pHK001.23
Plasmid#235484Purposedual NOT gate receiver with bs for sgRNA2 and sgRNA3DepositorInsertNOT gate
UseSynthetic BiologyAvailable SinceApril 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
pHK002.1
Plasmid#235460PurposeMessage phagemid carrying sgRNA1 (prom. J23119, backbone pBR322)DepositorInsertsgRNA1
UseSynthetic BiologyAvailable SinceApril 30, 2025AvailabilityAcademic Institutions and Nonprofits only