We narrowed to 65,358 results for: %s
-
Plasmid#87408Purposep426_Cas9_gRNA-ARS805a without ribozyme All-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS805a sequence TTATTTGAATGATATTTAGT in yeast chromosome 8.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS805a
UseCRISPRPromoterADH1, pTyrosineAvailable sinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-RDS1a
Plasmid#87385PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting RDS1a sequence ATTCAATACGAAATGTGTGC in yeast chromosome 3DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting RDS1a
UseCRISPRPromoterADH1, pTyrosineAvailable sinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
GALK1 gRNA (BRDN0001146506)
Plasmid#76703Purpose3rd generation lentiviral gRNA plasmid targeting human GALK1DepositorAvailable sinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
GALK1 gRNA (BRDN0001146311)
Plasmid#76704Purpose3rd generation lentiviral gRNA plasmid targeting human GALK1DepositorAvailable sinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
GALK1 gRNA (BRDN0001145418)
Plasmid#76705Purpose3rd generation lentiviral gRNA plasmid targeting human GALK1DepositorAvailable sinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
pET20b- hTPI Ile170Thr
Plasmid#50725Purposeoverexpression of the human TPI1 Ile170Thr allele in E.coliDepositorInsertTriosephosphate isomerase 1 (TPI1 Human)
Tags6xHIS tagExpressionBacterialMutationchanged Isoleucine 170 to ThreoninePromoterT7Available sinceFeb. 20, 2014AvailabilityAcademic Institutions and Nonprofits only -
pLENTICRISPR-ENO1-sgRNA1
Plasmid#165927PurposeCRISPR-mediated gene perturbation (knock-out) of ENO1DepositorPublicationAvailabilityAcademic Institutions and Nonprofits only -
pLENTICRISPR-ENO1-sgRNA2
Plasmid#165928PurposeCRISPR-mediated gene perturbation (knock-out) of ENO1DepositorPublicationAvailabilityAcademic Institutions and Nonprofits only -
pJK384.4
Plasmid#155369PurposedCas9 + PA4-mVenusDepositorInsertsdCas9 (bacteria)
PA4-mVenus
UseCRISPRExpressionBacterialMutationD10A H840A (catalytically inactive)AvailabilityAcademic Institutions and Nonprofits only -
pRZ180:[pA-BD9-S-BD5-S-(5'D)-EC-Ex1]-CMVp-[(G3p)RC-mK2-Ex1-miRS2-mK2-Ex2-miRS1-BSs-miRS3-BSs-pA]
Plasmid#251311PurposeExpression of mKate2 Exon 1 and 2 and ECFP-Ex1 for use in synthetic gene circuitsDepositorInsertmKate2 Exon 1 and 2 and EC-Ex1
ExpressionMammalianAvailable sinceApril 16, 2026AvailabilityAcademic Institutions and Nonprofits only -
pH6HTC_PRDX6-Halo
Plasmid#175338PurposeProduction of HaloTag fusion proteinDepositorPublicationAvailable sinceOct. 20, 2021AvailabilityAcademic Institutions and Nonprofits only -
-
CSNK1A1 gRNA (BRDN0001145680)
Plasmid#76189Purpose3rd generation lentiviral gRNA plasmid targeting human CSNK1A1DepositorAvailable sinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pET14b-PITPalpha
Plasmid#58256Purposebacterial expression of human PITP alphaDepositorAvailable sinceJuly 28, 2014AvailabilityAcademic Institutions and Nonprofits only -
cmv hTid Short H121Q
Plasmid#13710DepositorAvailable sinceMarch 5, 2007AvailabilityAcademic Institutions and Nonprofits only -
AAV phSyn1(S)-FLEX-tdTomato-WPRE
Plasmid#51505PurposeCan be used to generate AAV virus that will express tdTomato in the presence of Cre in neurons from the synapsin promoterDepositorInserttdTomato
UseAAVPromoterphSyn1Available sinceMay 1, 2014AvailabilityAcademic Institutions and Nonprofits onlyCited by -
AAV phSyn1(S)-FLEX-EGFP-WPRE
Plasmid#51504PurposeCan be used to generate AAV virus that will express EGFP in the presence of Cre in neurons from the synapsin promoterDepositorInsertEGFP
UseAAVPromoterphSyn1Available sinceMay 1, 2014AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pMRX-IZ-ANXA2-mRuby3
Plasmid#184889PurposeStable expression of ANXA2-mRuby3 (Annexin A2-mRuby3) in mammalian cellsDepositorAvailable sinceJune 10, 2022AvailabilityAcademic Institutions and Nonprofits only -
pMRX-IZ-ANXA5-mRuby3
Plasmid#184891PurposeStable expression of ANXA5-mRuby3 (Annexin A5-mRuby3) in mammalian cellsDepositorAvailable sinceJune 10, 2022AvailabilityAcademic Institutions and Nonprofits only -
G protein alpha-s-mCerulean
Plasmid#66084PurposeG protein alpha-s internally tagged with mCerulean and EE epitopeDepositorInsertG-alpha-s-EE-mCerulean (Gnas Rat, Aequorea victoria)
Tagsinternal EE epitope (residues 189-194 in alpha-s …ExpressionMammalianMutationBamHI sites in the alpha-s cDNA were removed and …PromoterCMVAvailable sinceAug. 18, 2015AvailabilityAcademic Institutions and Nonprofits only