We narrowed to 13,396 results for: CAN
-
Plasmid#60367PurposePlasmid for expression of an inactive mutant of bacterial RNase HI tagged with NLS-mCherry that can be used to detect R-loops. Confers resistance to Puromycin. Expression is inducible in T-REx cells.DepositorInsertRNase HI-D10R-E48R
UseTagsNLS from SV40 T antigen and mCherryExpressionMammalianMutationD10R+E48R; catalyticaly inactivePromoterCMV-tetAvailable sinceJan. 8, 2015AvailabilityAcademic Institutions and Nonprofits only -
pC0048-CMV-dPspCas13b-longlinker-ADAR2DD(E488Q)
Plasmid#103864PurposedPspCas13b-ADAR2DD(E488Q) fusion that can be used to selectively edit adenosine to inosine in RNA molecules when used in conjuction with a guide RNA. Longer linker than pC0039.DepositorInsertsUseCRISPRTagsGSGGGGS and HIV NESExpressionMammalianMutationChanged histidne 133 to alanine and histidine 105…PromoterAvailable sinceNov. 28, 2017AvailabilityAcademic Institutions and Nonprofits only -
pINDUCER11 (miR-RUG)
Plasmid#44363PurposeInducible lentiviral gene silencing vector. Insert PheSGly294, (XhoI to EcoR1; 1.4kb), can be replaced w mir30 based hairpin of interestDepositorInsertPheS Gly294
UseLentiviralTagsExpressionMutationPromoterAvailable sinceAug. 15, 2013AvailabilityAcademic Institutions and Nonprofits only -
PB-TRE-dCas9-VPR-pA-3xsgRNA-EF1a-Tet.O-T2A-PuroR-polyA
Plasmid#166693PurposeExpress dCas9-VPR in a doxycyclin-inducable system and 3 sgRNAs targeting the murine Cnga1 promoter. Can be stably integrated into the genome via the PiggyBac Transposon system.DepositorInsertsdCas9-VPR
3x Cnga1 promoter-targeting sgRNAs
UseCRISPRTagsExpressionMammalianMutationPromoterTRE and U6Available sinceFeb. 1, 2023AvailabilityAcademic Institutions and Nonprofits only -
GFP-BAZ1A
Plasmid#65371PurposeGFP-tagged BRD protein, which can be used to be expressed in mammalian cells.DepositorInsertBAZ1A (BAZ1A Human)
UseTagsEmGFP and V5ExpressionMammalianMutation796I compared to all reference sequencesPromoterCMVAvailable sinceJune 15, 2015AvailabilityAcademic Institutions and Nonprofits only -
pAAV-SCP1-dSa VPR mini.-2X snRP-1 Neurog2
Plasmid#99694PurposeExpresses dSa Cas9 fused to optimized combination of truncated activation domains from SCP1 promoter with dual snRP1 poly adenylation signal, and Sa sgRNA for Actc1, vector allows for strong activation of mouse Actc1, can be packaged and delivered as AAVDepositorArticleInsertdCas9 and gRNA targeting Actc1 (gRNA: GGTATATAAGGGGTTTTAAG) (Actc1 Synthetic, Mouse)
UseAAV and CRISPRTagsVPR miniExpressionMutationdead Cas9PromoterAvailable sinceJan. 16, 2020AvailabilityAcademic Institutions and Nonprofits only -
pC0050-CMV-dPspCas13b-longlinker-ADAR2DD(wt)
Plasmid#103866PurposedPspCas13b-ADAR2DD(wt) fusion that can be used to selectively edit adenosine to inosine in RNA molecules when used in conjuction with a guide RNA. Longer linker than pC0039.DepositorInsertsUseCRISPRTagsGSGGGGS and HIV NESExpressionMammalianMutationChanged histidne 133 to alanine and histidine 105…PromoterAvailable sinceNov. 28, 2017AvailabilityAcademic Institutions and Nonprofits only -
-
-
pMXs-IP-mCherry-TOSI
Plasmid#172496PurposemCherry-TOSI (TOr-Signal-Indicator) is a fluorescent reporter for mTORC1 signaling (monitoring PDCD4 degradation) which can be introduced to mammalian cells by retrovirus vector.DepositorInsertPDCD4 (Pdcd4 Mouse)
UseRetroviralTagsMcherryExpressionMammalianMutationPromoterMLV LTRAvailable sinceJuly 29, 2021AvailabilityAcademic Institutions and Nonprofits only -
pUC119-gRNA
Plasmid#52255PurposeCan use a PCR template to assemble new desired guide RNA. Contains an Arabidopsis U6 promoter to drive guide RNA (targeting AtPDS3 gene target site 1) expression with a TTTTTT as terminator.DepositorInsertguide RNA targeting AtPDS3 (PDS3 Mustard Weed)
UseCRISPR; Plant expressionTagsExpressionMutationPromoterArabidopsis U6 polymerase III promoterAvailable sinceMarch 20, 2014AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1 IGF1R-BirA(R118G)-HA
Plasmid#109232PurposeThis construct can be used in the BioID process to identify proteins that interact with the Insulin-like Growth Factor 1 Receptor (IGF1R).DepositorInsertIGF1R (IGF1R Human)
UseTagsBirA(R118G) (highly promiscuous form) and HAExpressionMammalianMutationPromoterT7Available sinceMay 3, 2018AvailabilityAcademic Institutions and Nonprofits only -
GFP-BRPF1
Plasmid#65382PurposeGFP-tagged BRD protein, which can be used to be expressed in mammalian cells.DepositorInsertBRPF1 (BRPF1 Human)
UseTagsEmGFP and V5ExpressionMammalianMutationnonePromoterCMVAvailable sinceMay 14, 2015AvailabilityAcademic Institutions and Nonprofits only -
pMXs-IP-mVenus-TOSI
Plasmid#172491PurposemVenus-TOSI (TOr-Signal-Indicator) is a fluorescent reporter for mTORC1 signaling (monitoring PDCD4 degradation) which can be introduced to mammalian cells by retrovirus vector.DepositorInsertPdcd4 (Pdcd4 Mouse)
UseRetroviralTagsmVenusExpressionMammalianMutationPromoterMLV LTRAvailable sinceOct. 28, 2021AvailabilityAcademic Institutions and Nonprofits only -
pmRFP-N1 human cofilin R21Q
Plasmid#51279Purposeexpresses human cofilin R21Q mutant fused to mRFP in mammalian cellsDepositorInsertcofilin 1 (CFL1 Human)
UseTagsmRFPExpressionMammalianMutationR21Q, non-rod-forming mutation that can be used t…PromoterCMVAvailable sinceFeb. 20, 2014AvailabilityAcademic Institutions and Nonprofits only -
-
pCRISPR-RFP entry
Plasmid#192278PurposeEntry vector for cloning MmCas12m spacers. RFP flanked by MmCas12m CRISPR repeats can be digested out with BbsI.DepositorInsertRFP flanked by type V-M CRISPR repeat sequences
UseCRISPRTagsExpressionBacterialMutationPromoterPJ23119Available sinceMay 24, 2023AvailabilityAcademic Institutions and Nonprofits only -
SYKA-c020
Plasmid#175489PurposeProtein expression in bacterial cells. Tandem SH2 domains, M6-N269. Can be used for crystallography.DepositorInsertSYK (SYK Human)
UseTagsHis6-TEVExpressionBacterialMutationPromoterAvailable sinceJan. 27, 2022AvailabilityAcademic Institutions and Nonprofits only -
pBZCas13b
Plasmid#89898PurposeBacterial expression for bzCas13b, driven by the lac promoter, and DR-spacer-DR sequence driven by js23119. New spacer sequences can be cloned in between the DRs by digesting the plasmid with BsaI.DepositorInsertCas13b
UseTagsExpressionBacterialMutationPromoterLacAvailable sinceMay 12, 2017AvailabilityAcademic Institutions and Nonprofits only -