We narrowed to 13,396 results for: CAN
-
Plasmid#103849PurposedPspCas13b-ADAR2DD(E488Q) fusion that can be used to selectively edit adenosine to inosine in RNA molecules when used in conjuction with a guide RNA.DepositorInsertsUseCRISPRTagsGS and HIV NESExpressionMammalianMutationChanged histidne 133 to alanine and histidine 105…PromoterCMVAvailable sinceNov. 28, 2017AvailabilityAcademic Institutions and Nonprofits only
-
MSCV-pU6-(BbsI)-CcdB-(BbsI)-Pgk-Puro-T2A-BFP
Plasmid#86457PurposeMouse stem cell retroviral vector including a puromycin resistance and BFP gene. sgRNA targets can be cloned in between the BbsI sitesDepositorInsertBFP
UseCRISPRTagsExpressionMammalianMutationPromoterPgkAvailable sinceFeb. 10, 2017AvailabilityAcademic Institutions and Nonprofits only -
-
pInducer-YAP1-S127A
Plasmid#213584PurposeDoxycycline inducible expression of YAP1-S127A cDNA in mammalian cellsDepositorInsertYAP1 (YAP1 Human)
UseLentiviralTagsHAExpressionMammalianMutationS127APromoterAvailable sinceMarch 11, 2024AvailabilityAcademic Institutions and Nonprofits only -
pcDNA4/TO/GFP-GIGYF1
Plasmid#141188PurposeExpresses GFP-GIGYF1 in mammalian cells, can be used to make inducible cell lineDepositorInsertGIGYF1 (GIGYF1 Human)
UseTagsGFPExpressionMammalianMutationPromoterCMVAvailable sinceJune 5, 2020AvailabilityAcademic Institutions and Nonprofits only -
-
pInducer-YAP1
Plasmid#213583PurposeDoxycycline inducible expression of YAP1 wild type cDNA in mammalian cellsDepositorInsertYAP1 (YAP1 Human)
UseLentiviralTagsHAExpressionMammalianMutationPromoterAvailable sinceMarch 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-SCP1-dSa VPR mini.-2X snRP-1 Actc1
Plasmid#99690PurposeExpresses dSa Cas9 fused to optimized combination of truncated activation domains from SCP1 promoter with dual snRP1 poly adenylation signal, and Sa sgRNA for Actc1, vector allows for strong activation of mouse Actc1, can be packaged and delivered as AAVDepositorArticleInsertdCas9 and gRNA targeting Actc1 (gRNA sequence: GCCATTCTTGGAGCCAAGGG ) (Actc1 Synthetic, Mouse)
UseAAV and CRISPRTagsVPR miniExpressionMutationdead Cas9PromoterAvailable sinceSept. 12, 2018AvailabilityAcademic Institutions and Nonprofits only -
pCENPTΔC-dCas9-3xGFP
Plasmid#198325PurposeExpresses CENPTΔC-dCas9-3xGFP protein in mammalian cells. When coupled with a guide RNA against a high repeat target locus, this can be applied to seed ectopic kinetochores at the target locusDepositorInsertCENPTΔC (CENPT Human)
UseLentiviralTagsEGFP x 3 and dCas9ExpressionMammalianMutationtruncation - encodes only amino acids 1-375PromoterCMV-TetOAvailable sinceApril 14, 2023AvailabilityAcademic Institutions and Nonprofits only -
pInducer-YAP1-S127A/S397A
Plasmid#213585PurposeDoxycycline inducible expression of YAP1-S127A/S397A cDNA in mammalian cellsDepositorInsertYAP1 (YAP1 Human)
UseLentiviralTagsHAExpressionMammalianMutationS127A, S397APromoterAvailable sinceMarch 11, 2024AvailabilityAcademic Institutions and Nonprofits only -
pTagGFP2-N SIN1 deltaCRIM
Plasmid#124921PurposeFor expression of Conserved Region In Middle deletion mutant of SIN1-GFP (delta139-267)DepositorInsertMAPKAP1 (MAPKAP1 Human)
UseTagsTagGFP2ExpressionMammalianMutationInsert ORF was sirently mutated to be resistent t…PromoterAvailable sinceMay 20, 2019AvailabilityAcademic Institutions and Nonprofits only -
pTagGFP2-N SIN1 deltaPH
Plasmid#124922PurposeFor expression of Pleckstrin Homology domain deletion mutant of SIN1-GFP (delta376-486)DepositorInsertMAPKAP1 (MAPKAP1 Human)
UseTagsTagGFP2ExpressionMammalianMutationInsert ORF was sirently mutated to be resistent t…PromoterAvailable sinceMay 20, 2019AvailabilityAcademic Institutions and Nonprofits only -
pC0047-CMV-dPspCas13b-ADAR1DD(E1008Q)
Plasmid#103863PurposedPspCas13b-ADAR1DD(E1008Q) fusion that can be used to selectively edit adenosine to inosine in RNA molecules when used in conjuction with a guide RNADepositorInsertsUseCRISPRTagsExpressionMammalianMutationChanged histidne 133 to alanine and histidine 105…PromoterAvailable sinceNov. 28, 2017AvailabilityAcademic Institutions and Nonprofits only -
-
pINDUCER13 (miR-LUP)
Plasmid#46936PurposeInducible lentiviral gene silencing vector. Insert PheSGly294, (XhoI to EcoRI; 1.4kb), can be replaced w mir30 based hairpin of interestDepositorInsertPheS Gly294
UseLentiviralTagsExpressionMutationPromoterAvailable sinceNov. 4, 2014AvailabilityAcademic Institutions and Nonprofits only -
1073A(HomeR1)=pBac-[Pol-γ35.HL-decPol-γ35-p10]-[U6-gRNA#1(Pol-γ35)]-[3xp3-GFP-SV40]-Pol-γ35.HR-[Opie2-dsRed-SV40]
Plasmid#159676PurposePlasmid provides the HomeR#1 gene drive element harboring a rescue, gRNA#1, and 3xP3-eGFP that can be integrated via pBac and inserted at Pol-γ35 site #1 via HDR.DepositorInsertpBac-[Pol-γ35.HL-decPol-γ35-p10]-[U6-gRNA#1(Pol-γ35)]-[3xp3-GFP-SV40]-Pol-γ35.HR-[Opie2-dsRed-SV40]
UseTagsExpressionInsectMutationPromoterAvailable sinceMarch 8, 2021AvailabilityAcademic Institutions and Nonprofits only -
CaTCH Dual-sgRNA_sgBC2-A_sgBC2-C
Plasmid#154197PurposeLentiviral expression plasmid encoding two sgRNAs without a target. These can be used as a off-target control for CaTCH barcode cassette BC1. Expresses Thy1.1 and a Neo selection marker.DepositorInsertsgRNA-BC2-A, sgRNA-BC2-C
UseLentiviral; Catch barcode activationTagsExpressionMammalianMutationPromoterhU6 and mU6Available sinceDec. 2, 2020AvailabilityAcademic Institutions and Nonprofits only -
pPbcas13b
Plasmid#89906PurposeBacterial expression for pbCas13b, driven by the lac promoter, and DR-spacer-DR sequence driven by js23119. New spacer sequences can be cloned in between the DRs by digesting the plasmid with BsaI.DepositorInsertCas13b
UseTagsExpressionBacterialMutationPromoterLacAvailable sinceMay 12, 2017AvailabilityAcademic Institutions and Nonprofits only -
pInducer-TAZ-S89A/S311A
Plasmid#213589PurposeDoxycycline inducible expression of TAZ-S89A/S311A cDNA in mammalian cellsDepositorInsertTAZ (WWTR1 Human)
UseLentiviralTags2xHAExpressionMammalianMutationS89A, S311APromoterAvailable sinceMarch 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-ITR-EcYtR(NGS-6)-mCherry
Plasmid#217363PurposeExpresses E. coli tyrosine tRNA variant "NGS-6" and a wild-type mCherry reporter; can be packaged into AAVDepositorInsertE. coli tyrosine tRNA mutant, "NGS-6"
UseAAVTagsExpressionMammalianMutationPromoterU6Available sinceApril 18, 2024AvailabilityAcademic Institutions and Nonprofits only