We narrowed to 40,342 results for: kan
-
Plasmid#65814PurposeNADPH dependent Alanine Dehydrogenase, Low Phosphate Dependent E. coli ExpressionDepositorInsertNADPH Alanine Dehydrogenase (ald Synthetic)
ExpressionBacterialMutationD196A, L197RPromoterInsulated waaHp from E. coliAvailable SinceJuly 24, 2015AvailabilityAcademic Institutions and Nonprofits only -
CC3
Plasmid#63715PurposeVoltage sensing domain of Ciona with the G122A/D164A/D186A/R217Q/R229I mutations fused to super ecliptic pHlorin A227DDepositorInsertCC3
TagsSuper ecliptic pHlorin A227DExpressionMammalianPromoterCMVAvailable SinceJuly 16, 2015AvailabilityAcademic Institutions and Nonprofits only -
pGAD-hPLEKHM1
Plasmid#64145PurposeFor yeast two hybridDepositorAvailable SinceApril 17, 2015AvailabilityAcademic Institutions and Nonprofits only -
pGMCK-0X750-luxAB-DAS+4
Plasmid#49517PurposeKanamycin resistant; expresses luxAB-DAS+4 under the control of a promoter containing PtetO-4C5G; integrates into the mycobacteriophage att-L5 siteDepositorInsertP750-luxAB-DAS+4
TagsDAS+4 (AANDENYSENYADAS)ExpressionBacterialPromoterP750Available SinceJan. 17, 2014AvailabilityAcademic Institutions and Nonprofits only -
CFP-GAI(1-151)
Plasmid#37308DepositorAvailable SinceJune 19, 2012AvailabilityAcademic Institutions and Nonprofits only -
pYL156 (TRV RNA2)
Plasmid#148969PurposeModified Tobacco Rattle Virus RNA 2; used for virus induced gene silencing in plants along with pYL192 (TRV RNA1)DepositorInsertModified TRV RNA2
UseT-dna vectorMutationsee comments section belowAvailable SinceJune 23, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAAV mGAD65(delE1) GFP WPRE SV40pA
Plasmid#177316PurposeTo produce the AAV vector that expresses GFP under the control of the mGAD65 promoter. The mGAD65 promoter has highly specificity to GABAergic interneurons.DepositorInsertmGAD65(delE1) promoter, GABAergic interneurons specific promoter
UseAAVAvailable SinceDec. 13, 2021AvailabilityAcademic Institutions and Nonprofits only -
pJRH-1363 LV EF1a-CD19 IRES-EGFP
Plasmid#201919Purpose2nd generation lentiviral transfer plasmid for engineering cells to express human CD19DepositorAvailable SinceAug. 9, 2023AvailabilityAcademic Institutions and Nonprofits only -
pXPR_BRD003 Ch2-2
Plasmid#184486PurposeLentivirus gRNA targeting Ch2-2 (control)DepositorInsertCh2-2
UseLentiviralAvailable SinceJune 24, 2022AvailabilityAcademic Institutions and Nonprofits only -
psPAX2-D64V-NC-MS2
Plasmid#122944PurposeMS2 coat protein-modified lentiviral packaging plasmid for packaging mRNA with an MS2 aptamer into lentivirus-like particlesDepositorInsertNC-MCP (MS2 coat protein) fusion protein in Gag
UseLentiviralExpressionMammalianMutationD64VAvailable SinceMarch 26, 2019AvailabilityAcademic Institutions and Nonprofits only -
psPAX2-D64V-NC-PP7
Plasmid#122945PurposePP7 coat protein-modified lentiviral packaging plasmid for packaging mRNA with an PP7 aptamer into lentivirus-like particlesDepositorInsertNC-PCP (PP7 coat protein) fusion protein in Gag
UseLentiviralExpressionMammalianMutationD64VAvailable SinceMarch 26, 2019AvailabilityAcademic Institutions and Nonprofits only -
pK18msB
Plasmid#177839PurposePlasmid for gene replacement using kanamycin/sucrose selection/counterselection. Derived from pK18mobsacB but reduced in size.DepositorTypeEmpty backboneUseBacterial gene replacementAvailable SinceAug. 25, 2022AvailabilityAcademic Institutions and Nonprofits only -
pDONR223_LacZ
Plasmid#25893PurposeGateway entry vector containing LacZ.DepositorInsertLacZ
UseGateway entry vectorAvailable SinceJuly 30, 2010AvailabilityAcademic Institutions and Nonprofits only -
pDONR223_Luciferase
Plasmid#25894PurposeGateway entry vector containing Luciferase.DepositorInsertLuciferase
UseGateway entry vectorAvailable SinceJuly 30, 2010AvailabilityAcademic Institutions and Nonprofits only -
pJRH-1365 LV EF1a-CD28 IRES-EGFP
Plasmid#201921Purpose2nd generation lentiviral transfer plasmid for engineering cells to express human CD28DepositorAvailable SinceAug. 9, 2023AvailabilityAcademic Institutions and Nonprofits only -
pJRH-1345 U6-B2M sgRNA Gag-Cas9 v2
Plasmid#201916PurposeCas9-EDV production plasmid. Expresses the v2 Gag-Cas9 polypeptide (CAG promoter) and B2M sgRNA (human U6 promoter, 5’-GAGTAGCGCGAGCACAGCTA)DepositorInsertsGag-Cas9 v2
B2M sgRNA (Target-specific sequence: 5'- GAGTAGCGCGAGCACAGCTA)
ExpressionMammalianPromoterCAG and Human U6Available SinceAug. 4, 2023AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3_NSlmb-vhhGFP4
Plasmid#35579DepositorInsertNSlmb-vhhGFP4 (slmb Fly)
ExpressionMammalianAvailable SinceApril 3, 2012AvailabilityAcademic Institutions and Nonprofits only -
pDIRECT_22C
Plasmid#91135PurposeDirect Cloning, Type: T-DNA, Engineering Reagent: 35S:Csy4-P2A-AtCas9 + CmYLCV:gRNAs with Csy4 spacers, Plant Selection: 2x35S:npt IIDepositorInsertEngineering Reagent: 35S:Csy4-P2A-AtCas9 + CmYLCV:gRNAs with Csy4 spacers
UseCRISPRExpressionPlantAvailable SinceJuly 7, 2017AvailabilityAcademic Institutions and Nonprofits only -
pGMCK-T38S38-750-luxAB-DAS+4
Plasmid#49518PurposeKanamycin resistant; expresses luxAB-DAS+4 under the control of a promoter containing PtetO-4C5G; constitutively expresses reverse TetR (tetR38); integrates into the mycobacteriophage att-L5 siteDepositorInsertT38S8-P750-luxAB-DAS+4
TagsDAS+4 (AANDENYSENYADAS)ExpressionBacterialPromoterP750Available SinceJan. 17, 2014AvailabilityAcademic Institutions and Nonprofits only -
Lenti-AsCpf1-Blast
Plasmid#84750PurposeExpresses human codon-optimized AsCpf1 protein and blasticidin resistance from EFS promoter. Lentiviral backbone.DepositorInsertAsCpf1
UseCRISPR and LentiviralTagsNLS-3xHA (C terminal on insert)ExpressionMammalianPromoterEFS-NSAvailable SinceDec. 21, 2016AvailabilityAcademic Institutions and Nonprofits only