We narrowed to 65,358 results for: %s
-
Plasmid#197422PurposeKnock out of EB3 in human cells by CRISPR/Cas9DepositorInsertMAPRE3 gRNA #2 (targets Exon 1) (MAPRE3 Human)
UseCRISPRAvailable sinceJune 26, 2023AvailabilityAcademic Institutions and Nonprofits only -
pSpCas9(BB)-2A-mCherry_MAPRE3-gRNA#3
Plasmid#197423PurposeKnock out of EB3 in human cells by CRISPR/Cas9DepositorInsertMAPRE3 gRNA #3 (targets Exon 1) (MAPRE3 Human)
UseCRISPRAvailable sinceJune 26, 2023AvailabilityAcademic Institutions and Nonprofits only -
pVRC8400-SARS-CoV-2-RBD-SD1-B.1.621-AVI
Plasmid#181703PurposeExpresses SARS-CoV-2 RBD-SD1 domain from the B.1.621 variant with single chain Fc, HRV3C protease cleavage site, and AVI tagDepositorInsertSARS-CoV-2-RBD-SD1-B.1.621 (S )
TagsAVI, HRV3C, and scFcExpressionMammalianMutationR346K, E484K, N501YAvailable sinceMarch 2, 2022AvailabilityAcademic Institutions and Nonprofits only -
pVRC8400-SARS-CoV-2-RBD-SD1-K417N-L452R-T478K-AVI
Plasmid#176457PurposeExpresses SARS-CoV-2 RBD-SD1 domain containing K417N-L452R-T478K mutations with single chain Fc, HRV3C protease cleavage site, and AVI tagDepositorInsertSARS-CoV-2-RBD-SD1-K417N-L452R-T478K (S )
TagsAVI, HRV3C, and scFcExpressionMammalianMutationK417N, L452R, T478KAvailable sinceMarch 2, 2022AvailabilityAcademic Institutions and Nonprofits only -
pVRC8400-SARS-CoV-2-RBD-SD1-K417N-E484K-N501Y-AVI
Plasmid#176450PurposeExpresses SARS-CoV-2 RBD-SD1 domain containing K417N-E484K-N501Y mutations with single chain Fc, HRV3C protease cleavage site, and AVI tagDepositorInsertSARS-CoV-2-RBD-SD1-K417N-E484K-N501Y (S )
TagsAVI, HRV3C, and scFcExpressionMammalianMutationK417N, E484K, N501YAvailable sinceMarch 2, 2022AvailabilityAcademic Institutions and Nonprofits only -
pVRC8400-SARS-CoV-2-RBD-SD1-K417T-E484K-N501Y-AVI
Plasmid#176451PurposeExpresses SARS-CoV-2 RBD-SD1 domain containing K417T-E484K-N501Y mutations with single chain Fc, HRV3C protease cleavage site, and AVI tagDepositorInsertSARS-CoV-2-RBD-SD1-K417T-E484K-N501Y (S )
TagsAVI, HRV3C, and scFcExpressionMammalianMutationK417T, E484K, N501YAvailable sinceMarch 2, 2022AvailabilityAcademic Institutions and Nonprofits only -
pVRC8400-SARS-CoV-2-NTD-B.1.617.1-AVI
Plasmid#176435PurposeExpresses SARS-CoV-2 NTD domain from the B.1.617.1 variant with single chain Fc, HRV3C protease cleavage site, and AVI tagDepositorInsertSARS-CoV-2-NTD-B.1.617.1 (S )
TagsAVI, HRV3C, and scFcExpressionMammalianMutationT95I, G142D, E154KAvailable sinceMarch 2, 2022AvailabilityAcademic Institutions and Nonprofits only -
pVRC8400-SARS-CoV-2-NTD-B.1.617.2-AVI
Plasmid#176436PurposeExpresses SARS-CoV-2 NTD domain from the B.1.617.2 variant with single chain Fc, HRV3C protease cleavage site, and AVI tagDepositorInsertSARS-CoV-2-NTD-B.1.617.2 (S )
TagsAVI, HRV3C, and scFcExpressionMammalianMutationT19R, G142D, E156del, F157del, R158GAvailable sinceMarch 2, 2022AvailabilityAcademic Institutions and Nonprofits only -
pVRC8400-SARS-CoV-2-NTD-B.1.1.7-AVI
Plasmid#176424PurposeExpresses SARS-CoV-2 NTD domain from the B.1.1.7 variant with single chain Fc, HRV3C protease cleavage site, and AVI tagDepositorInsertSARS-CoV-2-NTD-B.1.1.7 (S )
TagsAVI, HRV3C, and scFcExpressionMammalianMutation69-70 del, 144delAvailable sinceMarch 2, 2022AvailabilityAcademic Institutions and Nonprofits only -
pVRC8400-SARS-CoV-2-S2P-B.1.617.1-AVI
Plasmid#176333PurposeExpresses SARS-CoV-2 S2P protein from the B.1.617.1 variant with single chain Fc, HRV3C protease cleavage site, and AVI tagDepositorInsertSARS-CoV-2-S2P-B.1.617.1 (S )
TagsAVI, HRV3C, and scFcExpressionMammalianMutationT95I, G142D, E154K, L452R, E484Q, D614G, P681R, Q…Available sinceMarch 2, 2022AvailabilityAcademic Institutions and Nonprofits only -
F0TBY7
Plasmid#163245PurposeInducible expression of UniProt identifier F0TBY7DepositorInsertF0TBY7
Tags10xHis and T7ExpressionBacterialPromoterT7Available sinceJan. 27, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLD-puro-Cc-CR-PARK7WT-VA
Plasmid#115187PurposeLentiviral transduction and expression of CRISPR/Cas9-resistant PARK7WT into any mammalian cell (when using sgRNA seq agtacagtgtagccgtgatg)DepositorInsertCR (CRISPR/Cas9-resistant)-PARK7WT (PARK7 Human)
UseLentiviralTagsVersatile affinity tag (2XStreptactin II-6XHis-3X…Mutationc.150G>A (silent when translated to protein, c…PromoterCMVAvailable sinceMarch 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLD-puro-Cc-CR-PARK7V51G-VA
Plasmid#115188PurposeLentiviral transduction and expression of CRISPR/Cas9-resistant PARK7V51G into any mammalian cell (when using sgRNA seq agtacagtgtagccgtgatg)DepositorInsertCR (CRISPR/Cas9-resistant)-PARK7V51G (PARK7 Human)
UseLentiviralTagsVersatile affinity tag (2XStreptactin II-6XHis-3X…Mutationc.150G>A (silent when translated to protein, c…PromoterCMVAvailable sinceMarch 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLD-puro-Cc-CR-PARK7C53A-VA
Plasmid#115189PurposeLentiviral transduction and expression of CRISPR/Cas9-resistant PARK7C53A into any mammalian cell (when using sgRNA seq agtacagtgtagccgtgatg)DepositorInsertCR (CRISPR/Cas9-resistant)-PARK7C53A (PARK7 Human)
UseLentiviralTagsVersatile affinity tag (2XStreptactin II-6XHis-3X…Mutationc.150G>A (silent when translated to protein, c…PromoterCMVAvailable sinceMarch 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLD-puro-Cc-CR-PARK7H126A-VA
Plasmid#115190PurposeLentiviral transduction and expression of CRISPR/Cas9-resistant PARK7H126A into any mammalian cell (when using sgRNA seq agtacagtgtagccgtgatg)DepositorInsertCR (CRISPR/Cas9-resistant)-PARK7H126A (PARK7 Human)
UseLentiviralTagsVersatile affinity tag (2XStreptactin II-6XHis-3X…Mutationc.150G>A (silent when translated to protein, c…PromoterCMVAvailable sinceMarch 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLD-puro-Cc-CR-PARK7E163K-VA
Plasmid#115191PurposeLentiviral transduction and expression of CRISPR/Cas9-resistant PARK7E163K into any mammalian cell (when using sgRNA seq agtacagtgtagccgtgatg)DepositorInsertCR (CRISPR/Cas9-resistant)-PARK7E163K (PARK7 Human)
UseLentiviralTagsVersatile affinity tag (2XStreptactin II-6XHis-3X…Mutationc.150G>A (silent when translated to protein, c…PromoterCMVAvailable sinceMarch 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
STK24 gRNA (BRDN0001147108)
Plasmid#77055Purpose3rd generation lentiviral gRNA plasmid targeting human STK24DepositorAvailable sinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
STK24 gRNA (BRDN0001144978)
Plasmid#77056Purpose3rd generation lentiviral gRNA plasmid targeting human STK24DepositorAvailable sinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
STK24 gRNA (BRDN0001146213)
Plasmid#77057Purpose3rd generation lentiviral gRNA plasmid targeting human STK24DepositorAvailable sinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
STK24 gRNA (BRDN0001144931)
Plasmid#77058Purpose3rd generation lentiviral gRNA plasmid targeting human STK24DepositorAvailable sinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only