We narrowed to 6,023 results for: cat.2
-
Plasmid#216758PurposeAAV2 transfer vector with the CMV promoter for ubiquitous expression of SuperClomeleonDepositorInsertSuperClomeleon followed by WPRE and human growth hormone polyA terminator
UseAAVExpressionMammalianMutationS30R and 11 AA deletion in the Cerulean CFP moiet…PromoterCMV (cytomegalovirus)Available SinceApril 10, 2024AvailabilityAcademic Institutions and Nonprofits only -
(R)pGPD1(D)_P1(SBE109)
Plasmid#194993Purposepromoter of the gene glyceraldehyde-3-phosphate dehydrogenase from R. toruloides for a P1 position (overhangs R/D)DepositorInsert(R) pGPD (D)
ExpressionBacterialAvailable SinceFeb. 26, 2024AvailabilityAcademic Institutions and Nonprofits only -
pDY279
Plasmid#182959PurposeStr resistant,CoE1* ori. CRISPR/Cas9 gRNA under constitutive J23119 promoter. gRNA targeting E. coli ptsI codon 2~9. HRT has synonymous mutations in ptsI. (for 1st round editing)DepositorInsertgRNA (ttcaggcattttagcatccc), homologous repair template for ptsI
UseSynthetic BiologyExpressionBacterialAvailable SinceJan. 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLenti gRNA KO OCLNx2 spCas9-T2A-iRFP670-P2A-puro
Plasmid#208399Purposecodes for 2 gRNA-TracrRNA targeting human OCLN, Cas9, iRFP670 fluorescent protein and puromycin resistanceDepositorInserthU6-gRNA and hH1-gRNA targeting OCLN gene (OCLN Human)
UseCRISPR and LentiviralTagsiRFP670ExpressionMammalianAvailable SinceDec. 20, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLenti gRNA KO OCLNx2 spCas9-T2A-Crimson-P2A-puro
Plasmid#208398Purposecodes for 2 gRNA-TracrRNA targeting human OCLN, Cas9, E2-Crimson fluorescent protein and puromycin resistanceDepositorInserthU6-gRNA and hH1-gRNA targeting OCLN gene (OCLN Human)
UseCRISPR and LentiviralTagsE2-CrimsonExpressionMammalianAvailable SinceDec. 20, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLenti gRNA KO OCLNx2 spCas9-T2A-mNeonGreen-P2A-puro
Plasmid#208400Purposecodes for 2 gRNA-TracrRNA targeting human OCLN, Cas9, mNeonGreen fluorescent protein and puromycin resistanceDepositorInserthU6-gRNA and hH1-gRNA targeting OCLN gene (OCLN Human)
UseCRISPR and LentiviralTagsmNeonGreenExpressionMammalianAvailable SinceDec. 20, 2023AvailabilityAcademic Institutions and Nonprofits only -
(F)pGPD(G)_P2 (SBE110)
Plasmid#194992Purposepromoter of the gene glyceraldehyde-3-phosphate dehydrogenase from R. toruloides for a P2 position (overhangs F/G)DepositorInsert(F) pGPD (G)
ExpressionBacterialAvailable SinceDec. 7, 2023AvailabilityAcademic Institutions and Nonprofits only -
(I) pADH2 (J) P3 (SBE114)
Plasmid#187629Purposepromoter of the gene alcohol dehydrogenase 2 from R. toruloides for the P3 position (I/J)DepositorInsert(I) pADH2 (J)
ExpressionBacterialAvailable SinceDec. 7, 2023AvailabilityAcademic Institutions and Nonprofits only -
(F) pADH2 (G)_P2 (SBE113)
Plasmid#187628Purposepromoter of the gene alcohol dehydrogenase 2 from R. toruloides fro the P2 position (F/G)DepositorInsert(F) pADH2 (G)
ExpressionBacterialAvailable SinceDec. 7, 2023AvailabilityAcademic Institutions and Nonprofits only -
(F) pXYL (G) P1 (SBE216)
Plasmid#195017Purposepromoter of the gene xylose reductase from R. toruloides for the position P2 (F/G)DepositorInsert(F) pXYL (G)
ExpressionBacterialAvailable SinceNov. 21, 2023AvailabilityAcademic Institutions and Nonprofits only -
(R) pXYL (D) P1 (SBE215)
Plasmid#195016Purposepromoter of the gene xylose reductase from R. toruloides for the position P1 (R/D)DepositorInsert(R) pXYL (D)
ExpressionBacterialAvailable SinceNov. 21, 2023AvailabilityAcademic Institutions and Nonprofits only -
(R)pADH2(D)_P1(SBE214)
Plasmid#195015Purposepromoter of the gene alcohol dehydrogenase 2 from R. toruloides for the position P1DepositorInsert(B) pADH2 (R)
ExpressionBacterialAvailable SinceNov. 21, 2023AvailabilityAcademic Institutions and Nonprofits only -
(B) NAT marker (R) (SBE173)
Plasmid#195014Purposenourseothricin (NAT) resistance genes codon-optimized for R. toruloides and expressed under pXYL and tNOSDepositorInsertpXYL+NAT+tNOS
ExpressionBacterialPromoterpXYLAvailable SinceNov. 21, 2023AvailabilityAcademic Institutions and Nonprofits only -
(B) G418 marker (R) (SBE 137)
Plasmid#195011Purposegeneticin (G418) resistance genes codon-optimized for R. toruloides and expressed under pXYL and tNOSDepositorInsertpXYL+G418+tNOS
ExpressionBacterialPromoterpXYLAvailable SinceNov. 21, 2023AvailabilityAcademic Institutions and Nonprofits only -
(J) crtYB(K) G3 (SBE117)
Plasmid#194996PurposeRhodotorula toruloides gene phytoene synthase/lycopene cyclase (crtYB, RHTO_04605) for G3DepositorInsert(J) crtYB(K)
ExpressionBacterialAvailable SinceNov. 21, 2023AvailabilityAcademic Institutions and Nonprofits only -
(G) crtI (H) G2 (SBE116)
Plasmid#194995PurposeRhodotorula toruloides gene phytoene dehydrogenase (crtI, RHTO_04602) for G2DepositorInsert(G) crtI (H)
ExpressionBacterialAvailable SinceNov. 21, 2023AvailabilityAcademic Institutions and Nonprofits only -
(D) crtE (E)_G1 (SBE115)
Plasmid#194994PurposeRhodotorula toruloides gene geranylgeranyl diphosphate synthase (crtE, RHTO_02504) for G1DepositorInsert(D) crtE (E)
ExpressionBacterialAvailable SinceNov. 21, 2023AvailabilityAcademic Institutions and Nonprofits only -
(I) pGPD (J)_P3 (SBE111)
Plasmid#194990Purposepromoter of the gene glyceraldehyde-3-phosphate dehydrogenase from R. toruloides for a P3 position (I/J)DepositorInsert(I) pGPD (J)
ExpressionBacterialAvailable SinceNov. 21, 2023AvailabilityAcademic Institutions and Nonprofits only -
(S) insD_ku70 (Q) (SBE139)
Plasmid#187627Purposethe insertional region downstream for the deletion of the KU70 gene in R. toruloides. Overhangs S/QDepositorInsert(S) insD KU70 (Q)
ExpressionBacterialAvailable SinceNov. 21, 2023AvailabilityAcademic Institutions and Nonprofits only -
(P) insUP_ku70 (SBE138) (B)
Plasmid#187626Purposethe insertional region upstream for the deletion of the KU70 gene in R. toruloides. Overhangs P/BDepositorInsert(P) insUP KU70 (B)
ExpressionBacterialAvailable SinceNov. 21, 2023AvailabilityAcademic Institutions and Nonprofits only