174,526 results
-
Plasmid#133450PurposeExpresses SpyTag003-MBP (maltose binding protein) in bacterial cytoplasmDepositorInsertSpyTag003-MBP
TagsHis6 and Thrombin cleavage siteExpressionBacterialMutationPeptide tag added to N-terminus of MBP via a GSGE…PromoterT7Available SinceDec. 19, 2019AvailabilityAcademic Institutions and Nonprofits only -
STING-V1
Plasmid#124262PurposeC-terminally tagged STING with split Venus Construct for studying localisation of STING in different cellular compartmentsDepositorAvailable SinceMay 10, 2019AvailabilityAcademic Institutions and Nonprofits only -
pACYC-Taq
Plasmid#102793PurposeExpresses Taq DNA polymerase under WT T7 promoterDepositorInsertTaq DNA polymerase
ExpressionBacterialAvailable SinceJuly 3, 2018AvailabilityAcademic Institutions and Nonprofits only -
pEGFP-h53BP1 (siRNA resistant)
Plasmid#110301PurposeMammalian expression of a EGFP-tagged full length human 53BP1 (resistant to siRNA targeting AGAACGAGGAGACGGTAATAGTGGG)DepositorInsertp53-binding protein 1 (TP53BP1 Human)
TagsEGFPExpressionMammalianMutationGAACGAGGA to GAGCGGGGCAvailable SinceMay 23, 2018AvailabilityAcademic Institutions and Nonprofits only -
pINDUCER dCas9-TET1CD
Plasmid#101921PurposeThe dCas9-TET1CD fusion protein is cloned into the pINDUCER lentiviral backbone (Addgene plasmid# 46948).DepositorInsertdCas9-TET1CD
UseLentiviralExpressionMammalianAvailable SinceNov. 13, 2017AvailabilityAcademic Institutions and Nonprofits only -
pSFV-Helper1
Plasmid#92073PurposeThis is a plasmid for transcription of defective helper RNA, providing structural Semliki forest virus (SFV) proteins to package recombinant SFV genomes into virus like particles.DepositorInsertcDNA of SFV genome with deletion removing the nonstructural SFV proteins and also the viral RNA packaging signal.
UseHelper plasmid, for run-off transcription and rna…Available SinceJuly 26, 2017AvailabilityAcademic Institutions and Nonprofits only -
pNBU2_erm-TetR-P1T_DP-GH023
Plasmid#90324PurposeIntegration vector at an attB site in Bacteroides; contains 1kb cassette with both the P1T_DP aTC-inducible promoter (RBS GH023) and the consitutively-driven TetR by the P2-A21 promoterDepositorTypeEmpty backboneExpressionBacterialAvailable SinceMay 31, 2017AvailabilityAcademic Institutions and Nonprofits only -
pET-CjCas9
Plasmid#89754PurposeExpression of CjCas9 with His tag in E.coliDepositorInsertCjCas9
UseCRISPRTags6XHis, HA, and SV40 NLSExpressionBacterialPromoterT7Available SinceMay 25, 2017AvailabilityAcademic Institutions and Nonprofits only -
pGL4.0-TERT WT
Plasmid#84924Purposeluciferase reporter for TERT promoterDepositorAvailable SinceMarch 8, 2017AvailabilityAcademic Institutions and Nonprofits only -
Clover-Geminin(1-110)
Plasmid#83915PurposeFluorescent probe for M/G1 transitionDepositorInsertClover-Geminin(1-110)
UseLentiviralExpressionMammalianPromoterCMVAvailable SinceNov. 3, 2016AvailabilityAcademic Institutions and Nonprofits only -
pCSII-EF-miRFP709-hCdt(1/100)
Plasmid#80007PurposehCdt(1/100) fused with near-infrared fluorescent protein miRFP709 (G1 phase cell cycle reporter)DepositorAvailable SinceJuly 21, 2016AvailabilityAcademic Institutions and Nonprofits only -
pC003 - LshC2C2 locus into pACYC184 for spacer cloning
Plasmid#79152PurposeLshC2c2 locus in pACYC184 with BsaI sites for spacer cloningDepositorInsertLshC2c2 locus
Mutation*Available SinceJune 29, 2016AvailabilityAcademic Institutions and Nonprofits only -
Kras-Src FRET biosensor
Plasmid#78302PurposeFRET biosensor. To monitor Src kinase activity in mammalian cells by FRETDepositorInsertSrc biosensor
ExpressionMammalianPromoterCMVAvailable SinceJune 22, 2016AvailabilityAcademic Institutions and Nonprofits only -
R777-E283 Hs.ROCK1
Plasmid#70567PurposeGateway ORF clone of human ROCK1 [NM_005406.2] with stop codon (for native or N-terminal fusions)DepositorInsertROCK1 (ROCK1 Human)
UseGateway CloningAvailable SinceMarch 1, 2016AvailabilityAcademic Institutions and Nonprofits only -
pLenti-Cdc42-2G
Plasmid#68813PurposeFRET-based biosensor reporting on endogenous Cdc42 activation (for Lentivirus production)DepositorInsertCdc42 activation reporter
UseLentiviralTagsHis and MycExpressionMammalianPromoterCMVAvailable SinceMarch 1, 2016AvailabilityAcademic Institutions and Nonprofits only -
pCDH-EF1-copGFP-T2A-Puro
Plasmid#72263PurposeExpress copGFP and puromycin resistance gene under EF1 promoterDepositorInsertcopGFP-T2A-Puro
UseLentiviralExpressionMammalianPromoterelongation factor-1Available SinceJan. 11, 2016AvailabilityIndustry, Academic Institutions, and Nonprofits -
MSP2135
Plasmid#72248PurposeHuman expression plasmid for SpCas9-HF2 variant: CMV-T7-humanSpCas9-HF2(N497A, R661A, Q695A, Q926A, D1135E)-NLS-3xFLAGDepositorInsertmammalian codon-optimized Streptococcus pyogenes Cas9 HF2(N497A/R661A/Q695A/Q926A/D1135E)-NLS-3xFlag
UseCRISPRTags3x FLAG and NLSExpressionMammalianMutationN497A, R661A, Q695A, Q926A, and D1135EPromoterCMVAvailable SinceJan. 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
xlox(GFP)hTERT
Plasmid#69809PurposeMLV retroviral vector expressing the hTERT reverse transcriptase immortalizing gene and a GFP markerDepositorAvailable SinceOct. 19, 2015AvailabilityAcademic Institutions and Nonprofits only -
pMito-rxRFP1.1
Plasmid#67841Purposeredox-sensitive red fluorescent protein rxRFP1.1, mitochondrially localizedDepositorInsertrxRFP1.1 and mitochondrial localization sequence
TagsHis Tag and mitochondrial localization sequenceExpressionMammalianPromoterCMVAvailable SinceOct. 9, 2015AvailabilityAcademic Institutions and Nonprofits only -
pYPQ131A
Plasmid#69273PurposeGolden Gate entry vector; 1st gRNA under AtU6 promoterDepositorTypeEmpty backboneUseCRISPRAvailable SinceSept. 18, 2015AvailabilityAcademic Institutions and Nonprofits only