Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

pINDUCER dCas9-TET1CD
(Plasmid #101921)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 101921 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pINDUCER21 (ORF-EG)
  • Backbone manufacturer
    Addgene
  • Backbone size w/o insert (bp) 10591
  • Total vector size (bp) 16882
  • Vector type
    Mammalian Expression, Lentiviral
  • Selectable markers
    EGFP

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    30°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    dCas9-TET1CD
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    6291

Cloning Information

  • Cloning method Gateway Cloning
  • 5′ sequencing primer GGTAGGCGTGTACGGTGGGAG
  • 3′ sequencing primer TATCAACCACTTTGTACAAGA
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pINDUCER dCas9-TET1CD was a gift from Danwei Huangfu (Addgene plasmid # 101921 ; http://n2t.net/addgene:101921 ; RRID:Addgene_101921)
  • For your References section:

    TET proteins safeguard bivalent promoters from de novo methylation in human embryonic stem cells. Verma N, Pan H, Dore LC, Shukla A, Li QV, Pelham-Webb B, Teijeiro V, Gonzalez F, Krivtsov A, Chang CJ, Papapetrou EP, He C, Elemento O, Huangfu D. Nat Genet. 2018 Jan;50(1):83-95. doi: 10.1038/s41588-017-0002-y. Epub 2017 Dec 4. 10.1038/s41588-017-0002-y PubMed 29203910