We narrowed to 6,178 results for: cas9 expression plasmid
-
Plasmid#232093PurposeYeast CEN plasmid for galactose-inducible expression of spCas9 and Ec86 reverse transcriptase.DepositorInsertSpCas9 and Ec86 reverse transcriptase
UseCRISPRExpressionYeastMutationEc86 reverse transcriptase is codon optimized for…PromoterGAL1-GAL10Available SinceFeb. 25, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCas9-EcRT-GAL-Nat
Plasmid#232090PurposeYeast CEN plasmid for galactose-inducible expression of spCas9 and Ec86 reverse transcriptase.DepositorInsertSpCas9 and Ec86 reverse transcriptase
UseCRISPRExpressionYeastMutationEc86 reverse transcriptase is codon optimized for…PromoterGAL1-GAL10Available SinceFeb. 21, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCas9-EcRT-GAL-Kan
Plasmid#232092PurposeYeast CEN plasmid for galactose-inducible expression of spCas9 and Ec86 reverse transcriptase.DepositorInsertSpCas9 and Ec86 reverse transcriptase
UseCRISPRExpressionYeastMutationEc86 reverse transcriptase is codon optimized for…PromoterGAL1-GAL10Available SinceJan. 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
pEGB3 omega1 Tnos:BASTA:Pnos - P35S:hCas9:Tnos (GB3469)
Plasmid#160647Purposemodule containing the human codon optimized Cas9 and the BASTA selection markerDepositorInsertBASTA / Cas9
UseCRISPR and Synthetic BiologyExpressionPlantMutationBsaI and BsmBI sites removedPromoterPnos, P35SAvailable SinceDec. 7, 2020AvailabilityAcademic Institutions and Nonprofits only -
IGI-P0492 pHR-dCas9-NLS-VPR-mCherry
Plasmid#102245PurposeLentiviral expression of dCas9-VPR-mCherry fusion protein for CRISPRa.DepositorInsertdCas9-VPR-mCherry
UseCRISPR and LentiviralTagsNLS-VPR-mCherryExpressionMammalianPromoterCAGAvailable SinceOct. 25, 2017AvailabilityAcademic Institutions and Nonprofits only -
pT7-SpCas9_sgRNA-site1 (RTW443)
Plasmid#160136PurposeT7 promoter expression plasmid for in vitro transcription of SpCas9 sgRNA with spacer #1DepositorInsertSpCas9 sgRNA with spacer #1 (spacer=GGGCACGGGCAGCTTGCCGG)
UseIn vitro transcription of sgrna from t7 promoterPromoterT7Available SinceFeb. 8, 2021AvailabilityAcademic Institutions and Nonprofits only -
pT7-SpCas9_sgRNA-site2 (RTW448)
Plasmid#160137PurposeT7 promoter expression plasmid for in vitro transcription of SpCas9 sgRNA with spacer #2DepositorInsertSpCas9 sgRNA with spacer #2 (spacer=GTCGCCCTCGAACTTCACCT)
UseIn vitro transcription of sgrna from t7 promoterPromoterT7Available SinceFeb. 8, 2021AvailabilityAcademic Institutions and Nonprofits only -
-
-
Nsp2Cas9_AAV
Plasmid#192143PurposeExpresses Nsp2Cas9, and cloning backbone for sgRNADepositorInsertNsp2Cas9
UseAAVExpressionMammalianAvailable SinceApril 24, 2023AvailabilityAcademic Institutions and Nonprofits only