We narrowed to 16,087 results for: grna
-
Plasmid#80185Purpose3rd generation lentiviral gRNA plasmid, non-targeting control gRNADepositorInsertNon-targeting control gRNA
UseCRISPR and LentiviralExpressionMammalianPromoterhU6Available SinceAug. 30, 2016AvailabilityAcademic Institutions and Nonprofits only -
non-targeting control gRNA (BRDN0001147432)
Plasmid#80186Purpose3rd generation lentiviral gRNA plasmid, non-targeting control gRNADepositorInsertNon-targeting control gRNA
UseCRISPR and LentiviralExpressionMammalianPromoterhU6Available SinceAug. 30, 2016AvailabilityAcademic Institutions and Nonprofits only -
non-targeting control gRNA (BRDN0001147649)
Plasmid#80187Purpose3rd generation lentiviral gRNA plasmid, non-targeting control gRNADepositorInsertNon-targeting control gRNA
UseCRISPR and LentiviralExpressionMammalianPromoterhU6Available SinceAug. 30, 2016AvailabilityAcademic Institutions and Nonprofits only -
non-targeting control gRNA (BRDN0001148129)
Plasmid#80177Purpose3rd generation lentiviral gRNA plasmid, non-targeting control gRNADepositorInsertNon-targeting control gRNA
UseCRISPR and LentiviralExpressionMammalianPromoterhU6Available SinceAug. 30, 2016AvailabilityAcademic Institutions and Nonprofits only -
tRNA-gRNA position [M1_2] (GB1209)
Plasmid#75410PurposetRNA and scaffold for the assembly of GBoligomers for the first position (positon [M1_2]) of a polycistronic tRNA-gRNA regulated by the (monocot) U3 promoter (3-part multiplexing)DepositorInserttRNA-gRNA position [M1_2]
UseCRISPR and Synthetic BiologyExpressionPlantAvailable SinceAug. 5, 2016AvailabilityAcademic Institutions and Nonprofits only -
pBXMCS-2 Pconstitutive-sgRNA(Sth3)_gcrA2
Plasmid#133341Purposefor constitutive expression of a single guide RNA from Streptococcus thermophilus #3 with a seed region that targets gcrA gene's promoter on the template strand in Caulobacter crescentusDepositorInsertsgRNA_gcrA
UseCRISPRPromoterconstitutiveAvailabilityAcademic Institutions and Nonprofits only -
pX330-Flag-SpCas9-HF1 (without sgRNA)
Plasmid#92102PurposeExpression plasmid for human codon-optimized high-fidelity SpCas9-HF1, px330-like backbone (without U6-sgRNA coding sequence)DepositorInsert3xFlag-NLS-Streptococcus pyogenes Cas9-HF1-NLS
UseCRISPRTags3xFLAG and NLSExpressionMammalianMutationN497A, R661A, Q695A, Q926APromoterCbhAvailable SinceOct. 31, 2017AvailabilityAcademic Institutions and Nonprofits only -
pCK002_U6-Sa-sgRNA(mod)_EFS-SaCas9-2A-Puro_WPRE
Plasmid#85452PurposeLentiviral vector encoding modified SaCas9 system backbone bearing BsmBI site for new guide RNAs and puromycin selection marker.DepositorInsertU6-modified-sgRNA-Backbone-EFS-hSaCas9-2xNLS-2A-Puro
UseCRISPR and LentiviralTagsNLSExpressionMammalianAvailable SinceApril 19, 2017AvailabilityAcademic Institutions and Nonprofits only -
AAV-EFS-SaKKHABE8e-bGH-U6-sgRNA-BsmBI
Plasmid#189923PurposeAAV genome encoding SaKKHABE8e and Sa sgRNA cassette on a single AAV, with BsmBI sites for protospacer installationDepositorInsertSaABE8e V106W
UseAAVMutationnSaCas9 KKH, TadA ABE8e V106WPromoterEFSAvailable SinceSept. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
AAV-EFS-SauriABE8e-bGH-U6-sgRNA-BsmBI
Plasmid#189925PurposeAAV genome encoding SauriABE8e and Sa sgRNA cassette on a single AAV, with BsmBI sites for protospacer installationDepositorInsertSauriABE8e
UseAAVMutationSauriCas9 D15APromoterEFSAvailable SinceSept. 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
AAV-pCbh-SpRY[C-term]-gRNAentry (CA20)
Plasmid#197511PurposeCbh promoter expression plasmid for C-terminal intein-split AAV construct with C-term of SpRY and BsmBI entry cassette to clone SpCas9 gRNA spacerDepositorInsertAAV-[ITR]-pCbh-BPNLS-NpuC-SpRY[C-term]-BPNLS-gRNA[BsmBI]-pU6-[ITR]
UseAAV and CRISPRTagsBPNLS and BPNLS-NpuC(intein)MutationC-terminal mutations of SpRY(L1111R/D1135L/S1136W…PromoterCbhAvailable SinceMarch 6, 2023AvailabilityAcademic Institutions and Nonprofits only -
C-term AAV-SpCas9-VRQR-gRNA_entry (HES1477)
Plasmid#242660PurposeCBh promoter expression plasmid for C-terminal intein-split AAV construct with C-term of SpCas9-VRQR and pU6 SpCas9 gRNA entry cassetteDepositorInsertpAAV-pCbh-BPNLS-NpuC-SpCas9-VRQR-BPNLS-WPRE-bGH_PA-SpCas9_gRNA_entrycassette
UseAAV and CRISPRTagsBPNLSMutationVRQR mutations in SpCas9(S55R/D1135V/G1218R/R1335…PromoterCBhAvailable SinceOct. 9, 2025AvailabilityAcademic Institutions and Nonprofits only -
pU6-sgRNA EF1Alpha-puro-T2A-BFP
Plasmid#60955PurposeParental vector for the CRISPRi/a libraries. Expresses an sgRNA from the U6 promoter and a puromycin resistance cassette and BFP from the EF1Alpha promoterDepositorInsertssgGFP-NT2
puro-T2A-BFP
UseCRISPR and LentiviralExpressionMammalianAvailable SinceJan. 9, 2015AvailabilityAcademic Institutions and Nonprofits only -
Lenti_sgRNA(MS2)_MCP-KRAB-IRES-zsGreen1
Plasmid#138460Purposelenti sgRNA cloning backbone with MS2 loops and EF1a-MCP-KRABDepositorInsertMCP-KRAB-IRES-zsGreen1
UseCRISPR and LentiviralExpressionMammalianPromoterEF1AAvailable SinceOct. 7, 2020AvailabilityAcademic Institutions and Nonprofits only -
CAGGS-AsCpf1-2A-GFP-U6-sgRNA-cloning vector
Plasmid#159281PurposeA multicistronic vector with both CAGGS promoter-driven AsCpf1 and U6 promoter-driven single guide RNA (sgRNA)DepositorInsertAsCpf1-HA-2A-GFP
UseMulticistronic vector with both caggs promoter-dr…Tags3X HAExpressionMammalianPromoterU6Available SinceSept. 24, 2020AvailabilityAcademic Institutions and Nonprofits only -
pJRH-1345 U6-B2M sgRNA Gag-Cas9 v2
Plasmid#201916PurposeCas9-EDV production plasmid. Expresses the v2 Gag-Cas9 polypeptide (CAG promoter) and B2M sgRNA (human U6 promoter, 5’-GAGTAGCGCGAGCACAGCTA)DepositorInsertsGag-Cas9 v2
B2M sgRNA (Target-specific sequence: 5'- GAGTAGCGCGAGCACAGCTA)
ExpressionMammalianPromoterCAG and Human U6Available SinceAug. 4, 2023AvailabilityAcademic Institutions and Nonprofits only -
lenti sgRNA(MS2)_puro optimized backbone
Plasmid#73797Purposeoptimized lenti sgRNA cloning backbone with MS2 loops at tetraloop and stemloop 2 and EF1a-puro resistance marker. Contains BsmBI sites for insertion of spacer sequences.DepositorHas ServiceCloning Grade DNATypeEmpty backboneUseCRISPR and LentiviralExpressionMammalianPromoterU6 and EF1AAvailable SinceMarch 15, 2016AvailabilityAcademic Institutions and Nonprofits only -
pJRH-1346 U6-B2M sgRNA Gag-pol v2
Plasmid#201917PurposeCas9-EDV production plasmid. Expresses the Gag-pol (CAG promoter) and B2M sgRNA (human U6 promoter, 5’-GAGTAGCGCGAGCACAGCTA)DepositorInsertsGag-pol
B2M sgRNA (Target-specific sequence: 5'- GAGTAGCGCGAGCACAGCTA)
ExpressionMammalianPromoterCAG and Human U6Available SinceAug. 4, 2023AvailabilityAcademic Institutions and Nonprofits only -
Pzac2.1 U6-control sgRNA1, 2, 3_gfaABC1D mcherry SV40
Plasmid#179120PurposeExpresses control sgRNAs under the U6 promoter and mcherry protein specifically in astrocytesDepositorInsertcontrol sgRNA
UseAAVPromoterU6Available SinceNov. 4, 2022AvailabilityAcademic Institutions and Nonprofits only -
CMVp-dsRed2-Triplex-HHRibo-gRNA1-HDVRibo-pA
Plasmid#55201PurposePlasmid encoding the Ribozyme/gRNA architecture. This is a modified form of the original plasmid described in the paper (Construct 13). mKate2 was replaced with dsRed2 because of distribution issues.DepositorInsertdsRed2
UseSynthetic BiologyExpressionMammalianPromoterCMVAvailable SinceJune 16, 2014AvailabilityAcademic Institutions and Nonprofits only