We narrowed to 6,501 results for: nls
-
Plasmid#29246PurposePleiades (Ple) MiniPromoter expression pattern described in de Leeuw et al., MTM, 2014 (PMID: 24761428).DepositorInsertPle27 (CCL27 Human)
UsePleiades promoter project [sic, pleaides plieades]TagsIntron-LacZ-NLSAvailable sinceNov. 7, 2011AvailabilityIndustry, Academic Institutions, and Nonprofits -
pEMS1500
Plasmid#29248PurposePleiades (Ple) MiniPromoter expression pattern described in de Leeuw et al., MTM, 2014 (PMID: 24761428).DepositorInsertPle29 (CCL27 Human)
UsePleiades promoter project [sic, pleaides plieades]TagsIntron-LacZ-NLSAvailable sinceOct. 20, 2011AvailabilityIndustry, Academic Institutions, and Nonprofits -
N-term AAV-ABE8e-SpCas9(S55R) (CA21)
Plasmid#242659PurposeCBh promoter expression plasmid for N-terminal intein-split AAV construct with N-term of ABE8e-SpCas9(S55R) - to be used with eVRQR constructsDepositorInsertpAAV-pCBh-BPNLS(SV40)-TadA8e-gs-SpCas9(D10A;S55R)-[N-term]-NpuN-BPNLS(SV40)-WPRE-bGH_PA
UseAAV and CRISPRTagsBPNLS and NpuN(intein)-BPNLSMutationSpCas9(S55R)PromoterCBhAvailable sinceOct. 9, 2025AvailabilityAcademic Institutions and Nonprofits only -
LentiCRISPRv2-GFP-sgGAMT-1
Plasmid#261347PurposeLentiviral vector encoding GFP alongside Cas9 and a gRNA targeting GAMTDepositorInsertGAMT (GAMT Human)
UseCRISPR and LentiviralTagsNucleoplasmin NLS, FLAGExpressionMammalianPromoterEF-1alphaAvailable sinceSept. 15, 2026AvailabilityAcademic Institutions and Nonprofits only -
PB-PE SpG_ATH51
Plasmid#242072PurposeExpresses SpG_ATH51 prime editor and pegRNA in mammalian cellsDepositorInsertSpG_ATH51_H840A-PE2-MMLV-RT(dBB)-P2A-PAC_dTK(dBB)
UseCRISPR and Synthetic Biology; Piggybac transposonTagsbpSV40 NLSExpressionMammalianMutationectopic insertion of 7 amino acids of PID turn-he…Available sinceOct. 29, 2025AvailabilityAcademic Institutions and Nonprofits only -
B-HypaR-SpCas9
Plasmid#126764PurposeExpression plasmid for human codon-opt. increased fidelity Blackjack-Hypa2SpCas9 (w/o U6-sgRNA). Cleaves both 20nt and 5'-extended 21nt spacer containing sgRNAs with higher fidelity than Hypa2SpCas9.DepositorInsertB-Hypa2SpCas9
UseCRISPRTags3xFLAG and NLSExpressionMammalianMutationR661A; N692A; M694A; Q695A; H698A; amino acids 10…PromoterCBhAvailable sinceSept. 19, 2023AvailabilityAcademic Institutions and Nonprofits only -
ppBAalbNixE1E3E4 PUb-YFP
Plasmid#173666Purposetransgenesis vector for Aedes albopictus ectopic expression of the Nix geneDepositorInsertsNix masculinisation gene
YFP
TagsSV40 NLSExpressionInsectMutationNix isoforms with exons E1, E3, E4PromoterAedes aegypti PUb and ownAvailable sinceMay 11, 2022AvailabilityAcademic Institutions and Nonprofits only -
T7pr-His6-MBP-TEV-Cas9-BirA*
Plasmid#159993PurposeBacterial expression of Cas9-BirA*DepositorInsertCas9-BirA*
Tags6X-His, MBP, 3X-FLAG, NLSExpressionBacterialMutationD10A, H840APromoterT7Available sinceOct. 20, 2020AvailabilityAcademic Institutions and Nonprofits only -
pX330-Flag-eSpCas9 (without sgRNA; with silent mutations)
Plasmid#126754PurposeExpression plasmid for human codon-optimized increased fidelity eSpCas9 (without U6-sgRNA coding sequence, with silent mutations)DepositorInserteSpCas9
UseCRISPRTags3xFLAG and NLSExpressionMammalianMutationK848A, K1003A, R1060APromoterCBhAvailable sinceMarch 6, 2020AvailabilityAcademic Institutions and Nonprofits only -
pTE3314
Plasmid#107530PurposeExpresses human codon optimized FnCpf1(RVR mutant) in mammalian cells.DepositorInserthFnCpf1(RVR)
Tags3xHA and NLSExpressionMammalianMutationN607R, K613V, N617RPromoterCMVAvailable sinceJune 13, 2018AvailabilityAcademic Institutions and Nonprofits only -
pGC76
Plasmid#19641DepositorInsert<4xNLS-GFP::let-858(3’)
UseFlp/frtTags4xNLSExpressionWormAvailable sinceMarch 16, 2009AvailabilityAcademic Institutions and Nonprofits only -
pRDB-054_4x_crAGAT
Plasmid#261345PurposeLentiviral vector encoding enAsCas12a and a four-guide casette targeting human AGAT under puro selectionDepositorInsertAGAT (GATM Human)
UseCRISPR and LentiviralTagsNucleoplasmin NLS, 3xHAExpressionMammalianPromoterEF-1alphaAvailable sinceSept. 15, 2026AvailabilityAcademic Institutions and Nonprofits only -
PB-PE iSM_PPL2
Plasmid#235996PurposeExpresses iSM_PPL2 prime editor and pegRNA in mammalian cellsDepositorInsertiSM_PPL2_H840A-PE2-MMLV-RT(dBB)-P2A-PAC_dTK(dBB)
UseCRISPR and Synthetic Biology; Piggybac transposonTagsbpSV40 NLSExpressionMammalianMutationreplacement of 5 amino acids of Smac-Cas9 PL2 wit…Available sinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCY5h
Plasmid#160295PurposeYeast CRISPR plasmid targeting the hphMX cassetteDepositorInsertssgRNA expression cassette (with guide targeting hph: GACCTGATGCAGCTCTCGGA)
URA3 selection cassette
sgRNA expression cassette (without guide)
Cas9
UseCRISPRTags8xHis-tag and SV40 NLSAvailable sinceMarch 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCY5n
Plasmid#160296PurposeYeast CRISPR plasmid targeting the natMX cassetteDepositorInsertssgRNA expression cassette (with guide targeting nat: GTACCGCACCAGTGTCCCGG)
URA3 selection cassette
sgRNA expression cassette (without guide)
Cas9
UseCRISPRTags8xHis-tag and SV40 NLSAvailable sinceMarch 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
LLP782_Traptavidin-KRAB-CO
Plasmid#211775PurposeAviTag counterpart binding domain, Traptavidin, fused to transcriptional repressor KRAB, with GFP selectionDepositorInsertSpyCatcher-DNMT3A
Tags3xFLAGExpressionMammalianMutationLast 300 bp codon-optimised (CO) to detect DNMT3A…PromoterpEF1a and pSV40Available sinceFeb. 2, 2024AvailabilityAcademic Institutions and Nonprofits only -
LLP785_Traptavidin-DNMT3A-CO
Plasmid#211778PurposeAviTag counterpart binding domain, Traptavidin, fused to DNA methyltransferase DNMT3A, with GFP selectionDepositorInsertTraptavidin-EZH2
Tags3xV5ExpressionMammalianMutationLast 300 bp codon-optimised (CO) to detect EZH2 e…PromoterpEF1a and pSV40Available sinceDec. 15, 2023AvailabilityAcademic Institutions and Nonprofits only -
LLP781_SnoopCatcher-KRAB-CO
Plasmid#211774PurposeSnoopTag counterpart binding domain, SnoopCatcher, fused to transcriptional repressor KRAB, with GFP selectionDepositorInsertTraptavidin-KRAB
Tags3xV5ExpressionMammalianMutationLast 300 bp codon-optimised (CO) to detect KRAB e…PromoterpEF1a and pSV40Available sinceDec. 15, 2023AvailabilityAcademic Institutions and Nonprofits only -
prCOrev
Plasmid#153961PurposeUsed to detect crossover-type DNA recombination events elicited by iso-positional nicking of two homologous DNA fragments (recombination analogous to Holliday's model)DepositorInsert5' and 3' EGFP fragments sharing a 386-bp sequence, separated by a NeoR gene cassette and arranged in the opposite direction
UseRetroviral; A reporter plasmid detecting dna reco…TagsNLS-ZFExpressionMammalianMutationNo mutationPromoterLTRAvailable sinceOct. 22, 2020AvailabilityAcademic Institutions and Nonprofits only -
prCO
Plasmid#153960PurposeUsed to detect crossover-type DNA recombination events elicited by iso-positional nicking of two homologous DNA fragments (recombination analogous to Holliday's model)DepositorInsert5' and 3' EGFP fragments sharing a 386-bp sequence, separated by a NeoR gene cassette and arranged in the same direction
UseRetroviral; A reporter plasmid detecting dna reco…TagsNLS-ZFExpressionMammalianMutationNo mutationPromoterLTRAvailable sinceOct. 22, 2020AvailabilityAcademic Institutions and Nonprofits only