We narrowed to 3,785 results for: Atr
-
Plasmid#114308PurposeTET-inducible expression of the Neugenin 3 transcription factorDepositorInsertNgn3 (NEUROG3 Human)
UseLentiviralTagsExpressionMutationPromoterAvailable sinceSept. 11, 2018AvailabilityAcademic Institutions and Nonprofits only -
pCWXPGR-pTF-Ngn2
Plasmid#114280PurposeTET-inducible expression of the Ngn2 proteinDepositorInsertNeurogenin 2 (Neurog2 Mouse)
UseLentiviralTagsExpressionMutationPromoterAvailable sinceSept. 11, 2018AvailabilityAcademic Institutions and Nonprofits only -
-
pML104-HygMx4-URA3-3
Plasmid#232886PurposePlasmid expressing Cas9 and gRNA GAAGTAACAAAGGAACCTAG which targets the URA3 gene.DepositorInsertURA3 gRNA (URA3 Budding Yeast)
UseCRISPRTagsExpressionYeastMutationPromotersnR52Available sinceFeb. 26, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML104-HygMx4-URA3-2
Plasmid#232885PurposePlasmid expressing Cas9 and gRNA TCGTACCACCAAGGAATTAC which targets the URA3 gene.DepositorInsertURA3 gRNA (URA3 Budding Yeast)
UseCRISPRTagsExpressionYeastMutationPromotersnR52Available sinceFeb. 26, 2025AvailabilityAcademic Institutions and Nonprofits only -
FLAG-Ex1-17-deltaP1P2-PTPN22
Plasmid#195391PurposeMammalian expression of a human PTPN22 mutant (exon 1-17 without the P1 and P2 domains) with FLAG tagDepositorInsertPTPN22 (PTPN22 Human)
UseTagsFLAGExpressionMammalianMutationPTPN22 mutant containing exon 1 to 17 and lacking…PromoterAvailable sinceApril 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
FLAG-Ex1-17-deltaP2-PTPN22
Plasmid#195395PurposeMammalian expression of a human PTPN22 mutant (exon 1-17 without the P2 domain) with FLAG tagDepositorInsertPTPN22 (PTPN22 Human)
UseTagsFLAGExpressionMammalianMutationPTPN22 mutant containing exon 1 to 17 and lacking…PromoterAvailable sinceMarch 13, 2023AvailabilityAcademic Institutions and Nonprofits only -
FLAG-Ex1-17-deltaP1-PTPN22
Plasmid#195388PurposeMammalian expression of a human PTPN22 mutant (exon 1-17 without the P1 domain) with FLAG tagDepositorInsertPTPN22 (PTPN22 Human)
UseTagsFLAGExpressionMammalianMutationPTPN22 mutant containing exon 1 to 17 and lacking…PromoterAvailable sinceMarch 13, 2023AvailabilityAcademic Institutions and Nonprofits only -
pJK587
Plasmid#71696PurposeProduces Acetobacter aceti 1023 thioredoxin reductase 1 with a C-terminal His6 tag and Cys138>Ser mutant (AaTrxB1H6-C138S)DepositorInsertthioredoxin reductase 1
UseTagsHis6ExpressionBacterialMutationchanges cysteine-138 to serinePromoterT7Available sinceJan. 29, 2016AvailabilityAcademic Institutions and Nonprofits only -
pB33eCPX
Plasmid#23336DepositorInsertEnhanced Circularly Permuted Outer Membrane Protein X
UseTagsExpressionBacterialMutationPromoterAvailable sinceMarch 9, 2010AvailabilityAcademic Institutions and Nonprofits only