We narrowed to 24,867 results for: promoter
-
Plasmid#198529PurposeExpression of ATG9A-GFP fusion protein in mammalian cellsDepositorInsertATG9A (ATG9A Human)
TagsEGFPExpressionMammalianMutationsilent mutations in codons 4 and 775PromoterCMVAvailable SinceMarch 22, 2023AvailabilityAcademic Institutions and Nonprofits only -
pEF5B-FRT-GFP-αTAT1[D157N]
Plasmid#27100DepositorInsertαTubulin K40 acetyltransferase (ATAT1 Human)
TagsGFP and S-tagExpressionMammalianMutationD157NAvailable SinceJan. 5, 2011AvailabilityAcademic Institutions and Nonprofits only -
pS-cr:GFP
Plasmid#196295Purpose35S promoter-driven expression of the positive-sense TSWV S RNA segment encoding crRNA:GFP fusion in place of the NSsDepositorInsertFull length TSWV S antigenome encoding crRNA:GFP fusion in place of viral NSs
UseCRISPRTagsSpeI-DR-BsaI-DR-SpeIExpressionPlantPromoterduplicated cauliflower mosaic virus 35S promoterAvailable SinceApril 12, 2023AvailabilityAcademic Institutions and Nonprofits only -
pGWB535
Plasmid#74873PurposeGateway cloning compatible binary vector for C-terminal fusion with LUC (no promoter).DepositorTypeEmpty backboneExpressionPlantPromoterNo PromoterAvailable SinceOct. 14, 2016AvailabilityAcademic Institutions and Nonprofits only -
7TFP CDH1 reporter
Plasmid#91704Purposelentiviral luciferase reporter containing CDH1 promoterDepositorInsertCDH1 promoter (CDH1 Human)
UseLentiviral and LuciferaseTagsluciferaseExpressionMammalianPromoterCDH1Available SinceMay 31, 2017AvailabilityAcademic Institutions and Nonprofits only -
pLEX301-TagRFP
Plasmid#162035PurposeTagged vector controlDepositorTypeEmpty backboneUseLentiviralTagsRFPAvailable SinceDec. 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAP05
Plasmid#186261PurposesfGFP under light light responsive PEL222 promoter and EL222 under constitutively active BBa_J2305 promoterDepositorInsertsExpressionBacterialPromoterBBa_23105 (GGCTAGCTCAGTCCTAGGTACTATGCTAGC) and PE…Available SinceSept. 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
pGL3 basic E2
Plasmid#48747PurposeExpression of luciferase driven by mPer2 promoter fragment containing E-box2 (bases -112 to +98 with respect to transcription start site at +1)DepositorInsertmPer2 promoter/enhancer region containing E-box2 (-112 to +98)
UseLuciferaseAvailable SinceDec. 5, 2013AvailabilityAcademic Institutions and Nonprofits only -
pGWB540
Plasmid#74874PurposeGateway cloning compatible binary vector for C-terminal fusion with eYFP (no promoter).DepositorTypeEmpty backboneExpressionPlantPromoterNo PromoterAvailable SinceOct. 18, 2016AvailabilityAcademic Institutions and Nonprofits only -
Flag-ZDHHC11
Plasmid#231659PurposeExpresses human ZDHHC11 proteinDepositorAvailable SinceFeb. 27, 2025AvailabilityAcademic Institutions and Nonprofits only -
HA-TRIM28deltaLinker
Plasmid#124958PurposeMammalian expression of Human TRIM28 with deleted Linker region between CC and PHD domainsDepositorInserthTRIM28 (TRIM28 Human)
TagsHAExpressionMammalianMutationDeletion of linker region between CC domain and P…Available SinceMay 3, 2019AvailabilityAcademic Institutions and Nonprofits only -
pKRG3-mU6-PUb-3xFLAG-hSpCas9
Plasmid#162161PurposeExpresses 3xFLAG tagged hSpCas9 (Ae. aegypti PUb promoter) with cloning site for sgRNAs (Ae. aegypti U6 promoter)DepositorInsertshSpCas9
sgRNA
UseCRISPRTags3xFLAGExpressionInsectPromoterAe. aegypti PUb and Ae. aegypti U6Available SinceJan. 15, 2021AvailabilityAcademic Institutions and Nonprofits only -
pBLADE(FP6*)-mCherry
Plasmid#168048PurposeExpresses the synthetic gene BLADE FP6 under the constitutive J23101* promoter. mCherry expression is controlled by the PBAD promoter.DepositorInsertsBlue light-inducible AraC dimers in Escherichia coli
mCherry
ExpressionBacterialPromoterJ23101* and PBADAvailable SinceMay 11, 2021AvailabilityAcademic Institutions and Nonprofits only -
pGL4.24-Cd36-enhancer4
Plasmid#138576PurposeFirefly luciferase enhancer reporter fused with 1.5~2 kb fragments of mouse Cd36 enhancers at Chr5:17876439_17877752DepositorAvailable SinceMarch 26, 2020AvailabilityAcademic Institutions and Nonprofits only -
pKrox24(MapErk)Luc
Plasmid#200112PurposeLuciferase reporter for in cell monitoring of receptor tyrosine kinase-MAP ERK pathway activityDepositorInsertMapErk sequence in minimal promoter
ExpressionMammalianMutationhighly modified sequencePromoter5 copies of designed MapErk sequence in minimal p…Available SinceJune 29, 2023AvailabilityAcademic Institutions and Nonprofits only -
pBLADE(FP6**)-mCherry
Plasmid#168049PurposeExpresses the synthetic gene BLADE FP6 under the constitutive J23101** promoter. mCherry expression is controlled by the PBAD promoter.DepositorInsertsBlue light-inducible AraC dimers in Escherichia coli
mCherry
ExpressionBacterialPromoterJ23101** and PBADAvailable SinceMay 11, 2021AvailabilityAcademic Institutions and Nonprofits only -
pHS18 (mANGPTL3-Strep)
Plasmid#109111PurposeExpresses StrepII-tagged mouse ANGPTL3 in mammalian cellsDepositorAvailable SinceJune 5, 2018AvailabilityIndustry, Academic Institutions, and Nonprofits -
pGWB404
Plasmid#74798PurposeGateway cloning compatible binary vector for C-terminal fusion with sGFP (no promoter).DepositorTypeEmpty backboneExpressionPlantPromoterNo PromoterAvailable SinceJuly 18, 2016AvailabilityAcademic Institutions and Nonprofits only -
Accessory plasmid 2
Plasmid#128571Purposefor cloning identified individual SPECSDepositorTypeEmpty backboneUseLentiviralTagsTagRFPAvailable SinceJuly 31, 2020AvailabilityAcademic Institutions and Nonprofits only -
pDB6 (CK2alpha')
Plasmid#27084DepositorAvailable SinceOct. 14, 2011AvailabilityAcademic Institutions and Nonprofits only