-
Plasmid#221058PurposeExpression of H43K SUMO1 protein under T7 promoterDepositorInsertH43K site mutation on SUMO 1 (SUMO1 Human)
UseTagsHisExpressionBacterialMutationH43KPromoterT7Available sinceJan. 23, 2025AvailabilityAcademic Institutions and Nonprofits only -
H43S SUMO1
Plasmid#221059PurposeExpression of H43S SUMO1 protein under T7 promoterDepositorInsertH43S site mutation on SUMO 1 (SUMO1 Human)
UseTagsHisExpressionBacterialMutationH43SPromoterT7Available sinceJan. 23, 2025AvailabilityAcademic Institutions and Nonprofits only -
H75K SUMO1
Plasmid#221061PurposeExpression of H75K SUMO1 protein under T7 promoterDepositorInsertH75K site mutation on SUMO 1 (SUMO1 Human)
UseTagsHisExpressionBacterialMutationH75KPromoterT7Available sinceJan. 23, 2025AvailabilityAcademic Institutions and Nonprofits only -
H75S SUMO1
Plasmid#221062PurposeExpression of H75S SUMO1 protein under T7 promoterDepositorInsertH75S site mutation on SUMO 1 (SUMO1 Human)
UseTagsHisExpressionBacterialMutationH75SPromoterT7Available sinceJan. 23, 2025AvailabilityAcademic Institutions and Nonprofits only -
LentiCRISPRv2hyg-Ptgs1
Plasmid#170299PurposeA knock-out vector for the mouse Ptgs1DepositorInsertA gRNA targeting the mouse Ptgs1 gene.
UseCRISPR and LentiviralTagsExpressionMutationPromoterAvailable sinceJuly 8, 2021AvailabilityAcademic Institutions and Nonprofits only -
LentiCRISPRv2puro-Ptgfr
Plasmid#170303PurposeA knock-out vector for the mouse PtgfrDepositorInsertA gRNA targeting the mouse Ptgfr gene.
UseCRISPR and LentiviralTagsExpressionMutationPromoterAvailable sinceJuly 8, 2021AvailabilityAcademic Institutions and Nonprofits only -
BtGRK2[D110A K220R]-mVenus
Plasmid#137779PurposeVisualization of GRK2DepositorInsertBovine GRK2[D110A K220R] (GRK2 Bovine)
UseTagsExpressionMammalianMutationD110A K220RPromoterCMVAvailable sinceMarch 30, 2020AvailabilityAcademic Institutions and Nonprofits only -
HsGRK6[L66A E514A]-sYFP2
Plasmid#137781PurposeVisualization of GRK6DepositorInsertHuman GRK6[L66A E514A] (GRK6 Human)
UseTagsExpressionMammalianMutationL66A E514APromoterCMVAvailable sinceFeb. 27, 2020AvailabilityAcademic Institutions and Nonprofits only -
mei-S332 5.6Kb genomic DNA in Casper4
Plasmid#112984PurposeP element vector for transposon insertion of mei-S332 5.6Kb genomic DNA into Drosophila genomeDepositorInsertmei-S332 (Sgo) (mei-S332 Fly)
UseP insertion vectorTagsGFPExpressionMutationPromoterAvailable sinceSept. 4, 2018AvailabilityAcademic Institutions and Nonprofits only -
719-2µ-minHIS3
Plasmid#40610DepositorInsertHIS3 (HIS3 Budding Yeast, Synthetic)
UseTagsHAExpressionYeastMutationEvery codon of the coding sequence has been repla…PromoterTDH3Available sinceDec. 19, 2012AvailabilityAcademic Institutions and Nonprofits only -
CytERM-mKOkappa
Plasmid#98832PurposeIn vivo visualization of the ER (can be used for colocalization studies and the OSER assay)DepositorInsertCytERM
UseTagsmKOkappaExpressionMammalianMutationPromoterCMVAvailable sinceAug. 17, 2017AvailabilityAcademic Institutions and Nonprofits only -
CytERM_3xmTurquoise2
Plasmid#112958PurposeIn vivo visualization of the ER (can be used for colocalization studies and the OSER assay)DepositorInsertCytERM
UseTags3x mTurquoise2ExpressionMammalianMutationPromoterCMVAvailable sinceAug. 28, 2018AvailabilityAcademic Institutions and Nonprofits only -
pTfR-mTurquoise2
Plasmid#112953PurposeIn vivo visualization of Transferrin receptors (can be used for colocalization studies)DepositorInsertpTfR
UseTagsmTurquoise2ExpressionMammalianMutationPromoterCMVAvailable sinceSept. 25, 2018AvailabilityAcademic Institutions and Nonprofits only -
pGLU_103
Plasmid#225785PurposeThis is the promoter region taken from upstream of Tn5 transposase in pBAM1. It can be considered the "default" promoter to use.DepositorInsertPtn5_[Tn5]
UseSynthetic BiologyTagsExpressionMutationN/APromoterAvailable sinceSept. 27, 2024AvailabilityAcademic Institutions and Nonprofits only -
pGLU_85
Plasmid#225800PurposeThis is the promoter region taken from upstream of Himar transposase in pMarC9-Kan. It can be considered the "default" promoter to use.DepositorInsertPmarC9_[Himar]
UseSynthetic BiologyTagsExpressionMutationN/APromoterAvailable sinceSept. 26, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLSU1/o35S[]:MCS:NosT
Plasmid#212163PurposeThis binary vector has an empty backbone where you can insert a gene into a cassette with a strong promoter (original 35sCAMV)DepositorTypeEmpty backboneUseTagsExpressionPlantMutationPromoterAvailable sinceMarch 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLSU1/t35S[]:MCS:NosT
Plasmid#212164PurposeThis binary vector has an empty backbone where you can insert a gene into a cassette with a strong promoter (truncated35sCAMV)DepositorTypeEmpty backboneUseTagsExpressionPlantMutationPromoterAvailable sinceMarch 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
pTfR-mScarlet-I
Plasmid#112954PurposeIn vivo visualization of Transferrin receptors (can be used for colocalization studies)DepositorInsertpTfR
UseTagsmScarlet-IExpressionMammalianMutationPromoterCMVAvailable sinceAug. 28, 2018AvailabilityAcademic Institutions and Nonprofits only -
pEGFP-h53BP1 (siRNA resistant)
Plasmid#110301PurposeMammalian expression of a EGFP-tagged full length human 53BP1 (resistant to siRNA targeting AGAACGAGGAGACGGTAATAGTGGG)DepositorInsertp53-binding protein 1 (TP53BP1 Human)
UseTagsEGFPExpressionMammalianMutationGAACGAGGA to GAGCGGGGCPromoterAvailable sinceMay 23, 2018AvailabilityAcademic Institutions and Nonprofits only -
p-EF1a-CreERT2-3Xflag-T2A-eBFP2
Plasmid#170186PurposeThis Cre-ERT2 expressing construct can be used to inducibly recombine loxp sites. It can be used with poly-loxP containing plasmids to generate timestamp barcodes useful for linage tracingDepositorInsertCreERT2-T2A-eBFP2
UseLentiviralTagsExpressionMutationPromoterEF1 alphaAvailable sinceJuly 1, 2021AvailabilityAcademic Institutions and Nonprofits only