We narrowed to 4,431 results for: chm
-
Plasmid#122857PurposeMS2-modified guide RNA targeting the FT promoter with GreenGate E-F flanking sequencesDepositorInsertMS2-modified sgRNA targeting the Arabidopsis FT promoter
UseGolden gate compatible cloning vectorAvailable SinceMarch 26, 2019AvailabilityAcademic Institutions and Nonprofits only -
pCellFree_G03 RAP2A
Plasmid#67058PurposeStandard for cell-free expression benchmarking.DepositorAvailable SinceNov. 6, 2015AvailabilityAcademic Institutions and Nonprofits only -
pFS_0385_pET30-RT-CRISPR_Rivularia_sp._PCC_7116_ARRAY_1
Plasmid#116997PurposeExpresses RPCC7116RT-Cas1-Cas2 under pT7lac promoter, encodes RPCC7116CRISPR array 1, compatible with SENECA acquisition readoutDepositorInsertRivularia sp. PCC 7116 RT-Cas1-Cas2
ExpressionBacterialPromoterT7Available SinceNov. 29, 2018AvailabilityAcademic Institutions and Nonprofits only -
OA959C
Plasmid#104968PurposeExpresses anti-ZIKV transgene in Ae. aegyptiDepositorInsertAnti-Zika Transgene
Available SinceJan. 22, 2019AvailabilityAcademic Institutions and Nonprofits only -
pTG005
Plasmid#71386Purposelocalization of yeast RNase RMP1 (RNase MRP binding protein) in yeastDepositorAvailable SinceFeb. 5, 2016AvailabilityAcademic Institutions and Nonprofits only -
pCellFree_G03 STAT6
Plasmid#67123PurposeStandard for cell-free expression benchmarking.DepositorAvailable SinceNov. 6, 2015AvailabilityAcademic Institutions and Nonprofits only -
pCellFree_G03 TFDP3
Plasmid#67083PurposeStandard for cell-free expression benchmarking.DepositorAvailable SinceNov. 6, 2015AvailabilityAcademic Institutions and Nonprofits only -
pCellFree_G03 TFDP1
Plasmid#67084PurposeStandard for cell-free expression benchmarking.DepositorAvailable SinceNov. 6, 2015AvailabilityAcademic Institutions and Nonprofits only -
pCellFree_G03 TFDP2
Plasmid#67088PurposeStandard for cell-free expression benchmarking.DepositorAvailable SinceNov. 6, 2015AvailabilityAcademic Institutions and Nonprofits only -
pCellFree_G03 TFF1
Plasmid#67047PurposeStandard for cell-free expression benchmarking.DepositorAvailable SinceNov. 6, 2015AvailabilityAcademic Institutions and Nonprofits only -
pHREP-KD-2-shH2B
Plasmid#241996PurposeSleeping Beauty vector for inducible expression of a chicken H2B targeting shRNA using a shortened mir30 sequence. Allows co-selection with Puromycin.DepositorInsertH2B
ExpressionMammalianAvailable SinceFeb. 4, 2026AvailabilityAcademic Institutions and Nonprofits only -
pHREP-KD-2-shH2A
Plasmid#241997PurposeSleeping Beauty vector for inducible expression of a chicken H2A targeting shRNA using a shortened mir30 sequence. Allows co-selection with Puromycin.DepositorInsertH2A
ExpressionMammalianAvailable SinceFeb. 4, 2026AvailabilityAcademic Institutions and Nonprofits only -
pHREP-KD-1-shH2B
Plasmid#240417PurposeSleeping Beauty vector for inducible expression of a chicken H2B targeting shRNA using a shortened mir30 sequence. Allows co-selection with Puromycin.DepositorInsertH2B
ExpressionMammalianPromoterTREAvailable SinceFeb. 4, 2026AvailabilityAcademic Institutions and Nonprofits only -
pHREP-KD-2-shCtrl
Plasmid#240580PurposeSleeping Beauty vector for inducible expression of a unspecific control shRNA using a shortened mir30 sequence. Allows co-selection with Puromycin.DepositorInsertScramble shRNA
ExpressionMammalianAvailable SinceFeb. 4, 2026AvailabilityAcademic Institutions and Nonprofits only -
PINK1-SPARK
Plasmid#248086PurposePINK1 phase separation-based biosensorDepositorInsertPINK1-SPARK
ExpressionMammalianPromoterCMVAvailable SinceNov. 25, 2025AvailabilityAcademic Institutions and Nonprofits only -
PINK1-SPARK S/A
Plasmid#248087PurposePINK1-SPARK control construct with PINK1 phosphosite mutatedDepositorInsertPINK1-SPARK S/A
ExpressionMammalianPromoterCMVAvailable SinceNov. 25, 2025AvailabilityAcademic Institutions and Nonprofits only -
REV7 C-terminal sgRNA
Plasmid#207095PurposepX330 based plasmid for expression of Cas9 and the GCTCATAAAGGCAGCTGAGG sgRNA to target the REV7 locus.DepositorInsertGCTCATAAAGGCAGCTGAGG
ExpressionMammalianPromoterCMV and U6Available SinceMay 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
Halo XLF sgRNA
Plasmid#207605PurposesgRNA for the insert of the HaloTag at the endogenous loci of XLFDepositorInsertGTTCTTCCATctgcaaaaaa
TagsNoneExpressionMammalianAvailable SinceApril 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
HaloXRCC4 sgRNA
Plasmid#207606PurposesgRNA for the insert of the HaloTag at the endogenous loci of XRCC4.DepositorInsertTACTGGGTTCAGAAACAAGG
ExpressionMammalianAvailable SinceApril 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
pSuper TR G414C
Plasmid#207612PurposeU3 promoter driven expression of the telomerase RNA with a G414C CAB box mutationDepositorInsertTelomerase RNA G414C
ExpressionMammalianPromoterU1Available SinceJan. 16, 2025AvailabilityAcademic Institutions and Nonprofits only