We narrowed to 10,218 results for: yeast
-
Plasmid#188068PurposeFuncLib-designed high-redox potential laccase from Trametes hirsuta (Th3.14)DepositorInsertFuncLib-designed high-redox potential laccase from Trametes hirsuta
TagsS. cerevisiae evolved α-factor prepro-leader sign…ExpressionYeastMutation20 PROSS + 4 FuncLib mutations, described in publ…Available SinceOct. 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
pJRoC30_Th3
Plasmid#188064PurposePROSS-designed high-redox potential laccase from Trametes hirsutaDepositorInsertPROSS-designed high-redox potential laccase from Trametes hirsuta
TagsS. cerevisiae evolved α-factor prepro-leader sign…ExpressionYeastMutation20 mutations, described in publicationAvailable SinceOct. 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCfB3045(gRNA XI-3)
Plasmid#73287PurposeEasyClone-MarkerFree guiding RNA vector to direct Cas9 to cut at site XI-3DepositorInsertguiding RNA
UseCRISPR; GrnaExpressionYeastAvailable SinceNov. 23, 2016AvailabilityAcademic Institutions and Nonprofits only -
pRS416 Gal M337V YFP
Plasmid#27449DepositorInsertTDP-43 (TARDBP Human)
TagsYFPExpressionYeastMutationMethionine 337 mutated to Valine (M337V)Available SinceFeb. 10, 2011AvailabilityAcademic Institutions and Nonprofits only -
pGAN201
Plasmid#129204PurposeyTRAP sensor of [RNQ+], detects aggregation of Rnq1DepositorAvailable SinceOct. 8, 2019AvailabilityAcademic Institutions and Nonprofits only -
pPICZ-pre-pro-alphaf-E2-Crimson
Plasmid#117658PurposeTest intracellular localisation of E2-Crimson and study the secretion efficiencyDepositorInsertpre-pro-alphaf-E2-Crimson
ExpressionYeastMutationThis plasmid encodes the fluorescent protein E2-C…PromoterpAOX1Available SinceDec. 12, 2018AvailabilityAcademic Institutions and Nonprofits only -
POT2-RFP
Plasmid#65318Purposereceiving vector of standard transcription units(TUs) in YeastFab work, useful for further assemblyDepositorInsertRFP
UseSynthetic BiologyAvailable SinceFeb. 26, 2016AvailabilityAcademic Institutions and Nonprofits only -
pGZ173 (pFA6a-SL-MNase-kanMX6)
Plasmid#70234PurposeChEC-tagging vector encoding a short linker and aa 83-231 of Mnase in pFA6a-3HA-kanMX6 replacing the 3xHA tag. These vectors retain compatibility with the F2/R1 primer pairs commonly used for epitopeDepositorInsertShort linker and aa 83-231 of Mnase
UseYeast genomic targetingAvailable SinceNov. 18, 2015AvailabilityAcademic Institutions and Nonprofits only -
pRS416 Gal G294A YFP
Plasmid#27448DepositorInsertTDP-43 (TARDBP Human)
TagsYFPExpressionYeastMutationGlycine 294 mutated to Alanine (G294A)Available SinceFeb. 24, 2011AvailabilityAcademic Institutions and Nonprofits only -
pKMV-VioC
Plasmid#65349Purposesysthesis of vioC gene in the violacein pathwayDepositorInsertvioC
UseSynthetic BiologyAvailable SinceSept. 17, 2015AvailabilityAcademic Institutions and Nonprofits only -
pDN0606 (pDEST-DHFR F[3] N-term,HygR)
Plasmid#210488PurposepDEST vector to tag gene of interest with DHFR F[3] on the N-terminus to perform DHFR-PCA in S. cerevisiae.DepositorTypeEmpty backboneUseSynthetic Biology; Destination vector for gateway…ExpressionYeastPromoterADH1Available SinceDec. 22, 2023AvailabilityAcademic Institutions and Nonprofits only -
pKB11 (pDEST-DHFR F[1,2] C-term, NatR)
Plasmid#210485PurposepDEST vector to tag gene of interest with DHFR F[1,2] on the C-terminus to perform DHFR-PCA in S. cerevisiae.DepositorTypeEmpty backboneUseSynthetic Biology; Destination vector for gateway…ExpressionYeastPromoterADH1Available SinceDec. 22, 2023AvailabilityAcademic Institutions and Nonprofits only -
pDN0605 (pDEST-DHFR F[1,2] N-term, NatR)
Plasmid#210487PurposepDEST vector to tag gene of interest with DHFR F[1,2] on the N-terminus to perform DHFR-PCA in S. cerevisiae.DepositorTypeEmpty backboneUseSynthetic Biology; Destination vector for gateway…ExpressionYeastPromoterADH1Available SinceDec. 4, 2023AvailabilityAcademic Institutions and Nonprofits only -
MmSphk2
Plasmid#118598PurposeExpresses sphingosine kinase 2, which catalyzes the phosphorylation of sphingosine to form sphingosine 1-phosphate in miceDepositorAvailable SinceSept. 28, 2021AvailabilityAcademic Institutions and Nonprofits only -
pOP459
Plasmid#85933PurposeEncodes the Anti-Ebola 2G4 monoclonal antibody. Chimeric - mouse variable regions, human constant regions.DepositorInsertAnti-Ebola 2G4 monoclonal antibody
ExpressionYeastPromoterAOX1Available SinceOct. 31, 2017AvailabilityAcademic Institutions and Nonprofits only -
POT4-RFP
Plasmid#65320Purposereceiving vector of standard transcription units(TUs) in YeastFab work, useful for further assemblyDepositorInsertRFP
UseSynthetic BiologyAvailable SinceMarch 28, 2016AvailabilityAcademic Institutions and Nonprofits only -
pKMV-VioE
Plasmid#65351Purposesysthesis of vioE gene in the violacein pathwayDepositorInsertvioE
UseSynthetic BiologyAvailable SinceSept. 17, 2015AvailabilityAcademic Institutions and Nonprofits only -
pPGP_scFv
Plasmid#183732PurposeExpresses anti-lysozyme scFv antibodyDepositorInsertAnti-lysozyme scFv
TagsHis6-tagExpressionYeastPromoterGAP promoterAvailable SinceFeb. 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
pOP462
Plasmid#85935PurposeEncodes the Anti-Ebola 13C6 monoclonal antibody. Chimeric - mouse variable regions, human constant regions.DepositorInsertAnti-Ebola 13C6 monoclonal antibody
ExpressionYeastPromoterAOX1Available SinceOct. 31, 2017AvailabilityAcademic Institutions and Nonprofits only -
pDDGFP-Leu2d-GgKDELR2
Plasmid#123618PurposeExpresses WT GgKDELR2 in S. cerevisiae cells using Galactose induction, -URA and -Leu selectionDepositorAvailable SinceMay 20, 2019AvailabilityAcademic Institutions and Nonprofits only -
pKMV-VioA
Plasmid#65347Purposesysthesis of vioA gene in the violacein pathwayDepositorInsertvioA
UseSynthetic BiologyAvailable SinceSept. 17, 2015AvailabilityAcademic Institutions and Nonprofits only -
pCS2+ cMyc Dam_f_GFPoNLS
Plasmid#85820PurposeiDamID plasmid. To express transiently the c-Myc-tagged , L122A-mutant E. coli Dam adenine methyltransferase fused to the nuclear-localized mmGFP via flexylinker.DepositorInsertcMyc Dam_f_GFPoNLS
TagscMyc and oNLS (optimized nuclear localization sig…ExpressionBacterial, Insect, Mammalia…MutationL122A.Available SinceJan. 25, 2017AvailabilityAcademic Institutions and Nonprofits only -
pRS416 Gal TDP43 Q331K
Plasmid#27461DepositorAvailable SinceJan. 31, 2011AvailabilityAcademic Institutions and Nonprofits only -
pRS416 Gal TDP43 M337V
Plasmid#27460DepositorAvailable SinceJan. 24, 2011AvailabilityAcademic Institutions and Nonprofits only -
pEasyG3_hph
Plasmid#184919PurposeTemplate to generate via PCR two gRNAs for expression in S. cerevisiae. The PCR product from pEasyG3_hph recombines in vivo with a PCR product from pEasyG3_mic.DepositorInsertgRNA scaffold
UseCRISPRExpressionBacterialAvailable SinceOct. 28, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCfB3020(gRNA X-2)
Plasmid#73282PurposeEasyClone-MarkerFree guiding RNA vector to direct Cas9 to cut at site X-2DepositorInsertguiding RNA
UseCRISPR; GrnaExpressionYeastAvailable SinceNov. 23, 2016AvailabilityAcademic Institutions and Nonprofits only -
pCfB3042(gRNA X-4)
Plasmid#73284PurposeEasyClone-MarkerFree guiding RNA vector to direct Cas9 to cut at site X-2DepositorInsertguiding RNA
UseCRISPR; GrnaExpressionYeastAvailable SinceNov. 23, 2016AvailabilityAcademic Institutions and Nonprofits only -
pDIV494
Plasmid#177701PurposePlasmid expressing optimized Cas9 and NAT marker and sgRNA targeting ADE2 locus in D. hanseniiDepositorInsertsCas9
Nat
sgRNA Targeting ADE2 locus in D.hansenii: AGCTAAGCAGATTAATGCAT
UseCRISPRTagsSV40ExpressionBacterial and YeastPromoterRNR2p (Debaryomyces hansenii ), SNR52p (Candida s…Available SinceMarch 11, 2022AvailabilityAcademic Institutions and Nonprofits only -
HsSPHK2
Plasmid#118092PurposeExpresses sphingosine kinase 2, which catalyzes the phosphorylation of sphingosine to sphingosine-1-phosphate (S1P)DepositorAvailable SinceAug. 29, 2022AvailabilityAcademic Institutions and Nonprofits only -
pOP461
Plasmid#85934PurposeEncodes the Anti-Ebola 4G7 monoclonal antibody. Chimeric - mouse variable regions, human constant regions.DepositorInsertAnti-Ebola 4G7 monoclonal antibody
ExpressionYeastPromoterAOX1Available SinceOct. 31, 2017AvailabilityAcademic Institutions and Nonprofits only