We narrowed to 3,878 results for: Atr
-
Plasmid#194536PurposeLow copy vector backbone with nourseothricin selectivity, encodes for TDH3(pr) driven expression of mNeonDepositorInsertnatAC
ExpressionYeastPromoterTDH3Available SinceOct. 31, 2024AvailabilityAcademic Institutions and Nonprofits only -
pRSII42N-TDH3pr-mNeon
Plasmid#194537PurposeHigh copy vector backbone with nourseothricin selectivity, encodes for TDH3(pr) driven expression of mNeonDepositorInsertnatAC
ExpressionYeastPromoterTDH3Available SinceOct. 31, 2024AvailabilityAcademic Institutions and Nonprofits only -
pRSII41H-TDH3pr-mNeon
Plasmid#194538PurposeLow copy vector backbone with hygromycin B selectivity, encodes for TDH3(pr) driven expression of mNeonDepositorInserthphMX
ExpressionYeastPromoterTDH3Available SinceOct. 31, 2024AvailabilityAcademic Institutions and Nonprofits only -
pMS161
Plasmid#215683PurposeGuide only plasmid targeting chrIII split hygromycinR landing padDepositorInsertU6p::GTCCAGCGGCAGATCGGCGG
UseCRISPRExpressionWormAvailable SinceMarch 25, 2024AvailabilityAcademic Institutions and Nonprofits only -
pMS160
Plasmid#215682PurposeGuide only plasmid targeting chrI split hygromycinR landing padDepositorInsertU6p::GTTTGAGTAGAGCACTCAGG
UseCRISPRExpressionWormAvailable SinceMarch 21, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCMV-pOTC-GFP
Plasmid#205724PurposeExpression of GFP fused with pOTC, a leader peptide from mitochondrial matrix enzyme ornithine transcarbamylaseDepositorInsertpOTC-GFP
ExpressionMammalianAvailable SinceJan. 26, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCS2-Opto-BMPR2a
Plasmid#207616PurposeZebrafish BMPR2a BMP receptor kinase domain and CTD fused to VfLOVDepositorInsertBMPR2a kinase domain and CTD + VfLOV domain (bmpr2a Zebrafish, Vaucheria frigida)
Available SinceOct. 4, 2023AvailabilityAcademic Institutions and Nonprofits only -
pDONR221-W279A-short-UBASH3A-Ctag
Plasmid#195402PurposeHuman W279A short-form UBASH3A in Gateway pDONR221 (for C-terminal tag)DepositorAvailable SinceMarch 27, 2023AvailabilityAcademic Institutions and Nonprofits only -
pDONR221-K202R-short-UBASH3A-Ctag
Plasmid#195399PurposeHuman K202R short-form UBASH3A in Gateway pDONR221 (for C-terminal tag)DepositorAvailable SinceMarch 24, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAc5.1B-HA-DmHPat_500-968-dsRNAres_J
Plasmid#146693PurposeInsect Expression of DmHPat_500-968-dsRNAresDepositorInsertDmHPat_500-968-dsRNAres (Patr-1 Fly)
ExpressionInsectAvailable SinceMarch 16, 2023AvailabilityAcademic Institutions and Nonprofits only