We narrowed to 19,450 results for: cat
-
Plasmid#110196PurposeEncodes for human CXCR4 coding sequence tagged with the mTQ2 FPDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInserthCXCR4 (CXCR4 Human)
TagsmTurquoise (mTQ2)ExpressionMammalianPromoterCMVAvailable sinceMay 15, 2018AvailabilityAcademic Institutions and Nonprofits only -
pMXS-IRES-Blast SHMT2res
Plasmid#106301PurposeExpresses SHMT2DepositorInsertserine hydroxymethyltransferase 2 (SHMT2 Human)
UseRetroviralExpressionMammalianMutationSilent mutations destroy sgRNA targeting sitesAvailable sinceApril 30, 2018AvailabilityAcademic Institutions and Nonprofits only -
VCP F11.4 gRNA
Plasmid#90938Purpose3rd generation lentiviral gRNA plasmid targeting human VCPDepositorInsertVCP (Guide Designation F11.4)
UseCRISPR and LentiviralPromoterU6Available sinceJuly 18, 2017AvailabilityAcademic Institutions and Nonprofits only -
CDK7 gRNA (BRDN0001146106)
Plasmid#76078Purpose3rd generation lentiviral gRNA plasmid targeting human CDK7DepositorAvailable sinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
Rgl2-CAAX-pcw107-V5
Plasmid#64641Purposewhen used to produce lentivirus, express physiological levels of insertDepositorInsertRgl2 plus C-term KRAS (Kras Mouse)
UseLentiviralTagsV5MutationC-term of KrasPromoterPGKAvailable sinceDec. 3, 2015AvailabilityAcademic Institutions and Nonprofits only -
JNK2 WT O/E (MAPK9)-pcw107-V5
Plasmid#64617Purposewhen used to produce lentivirus, express physiological levels of insertDepositorInsertMAPK9 (transcript variant JNK2-a2) (MAPK9 Human)
UseLentiviralTagsV5MutationnonePromoterPGKAvailable sinceNov. 30, 2015AvailabilityAcademic Institutions and Nonprofits only -
3xFN-Tel-TAL/pCMV-7.1
Plasmid#63589PurposeExpresses a 3xFLAG-tagged TAL protein recognizing a telomere repeat.DepositorInsert3xFVN-Tel-TAL
UseTALENTags3xFLAG-tag, V5-tag, and nuclear localization sign…ExpressionMammalianPromoterCMVAvailable sinceApril 2, 2015AvailabilityAcademic Institutions and Nonprofits only -
pT7-agrBD-IV
Plasmid#53440PurposeDerivative of pT7-agrBD-I with a point mutation in the agrD gene to change AIP coding region from type-I to type-IVDepositorInsertagrBD locus (with D29Y mutation in agrD)
UseSynthetic BiologyTagsV5 epitope, 6x HIS (not expressed on agrB or agrD…ExpressionBacterialMutationD to Y mutation of residue 29 of the agrD gene (c…PromoterT7-lacAvailable sinceJune 3, 2014AvailabilityAcademic Institutions and Nonprofits only -
pET21c-IF3mt
Plasmid#31078DepositorInsertMature form human mitochondrial translational initiation factor 3 (MTIF3 Human)
TagsHisExpressionBacterialMutationIncludes coding sequence for the mature form. Ami…Available sinceAug. 24, 2011AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pcDNA3 PARL-FLAG-CT H335G
Plasmid#13749DepositorPublicationTagsFLAGExpressionMammalianMutationChanged catalytic His 335 to GlyAvailable sinceFeb. 1, 2007AvailabilityAcademic Institutions and Nonprofits only -
CCR5-SZ190b-sfGFP
Plasmid#162447PurposeExpression in HEK293T cell and compete ligand singaling against full-length receptors, the truncated receptor can perform signaling at high ligand concentrationDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertC-C chemokine receptor type 5 (CCR5 Human)
ExpressionMammalianMutationtruncation from aa88 to aa249PromoterCMVAvailable sinceAug. 20, 2021AvailabilityAcademic Institutions and Nonprofits only -
Orai1-jGCaMP8f
Plasmid#231630PurposeGreen fluorescent reporter of Orai1-associated calcium influxDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertOrai1-jGCaMP8f (ORAI1 Synthetic, Human)
TagsjGCaMP8fExpressionMammalianPromoterCMV Immediate EarlyAvailable sinceFeb. 21, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCMV-Myc-HNF4A
Plasmid#219396PurposeExpress HNF4A in mammalian cellsDepositorAvailable sinceJune 17, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCALNL-Rheb(S16H)
Plasmid#194204PurposeCre/LoxP-dependent expression of a constitutively active form of Rheb (S16H). Expression of Cre excises a STOP codon before Rheb(S16H), facilitating expression of a constitutively active form of Rheb.DepositorInsertRas Homolog Enriched Protein in Brain (S16H) (RHEB Human)
UseCre/LoxExpressionMammalianMutationS16HAvailable sinceJan. 25, 2023AvailabilityAcademic Institutions and Nonprofits only -
AAV_pMBP-dnVamp2-P2AT2A-EGFP-caax
Plasmid#190153PurposeExpresses dominant-negative Vamp2 (mouse Vamp2 AA 1-94) plus membrane-targeted EGFP in oligodendrocytes; AAV vectorDepositorInsertVamp2 (Vamp2 Mouse)
UseAAVTagsP2AT2A-EGFP-caaxExpressionMammalianMutationTruncation that includes only AA #1-94PromoterMBPAvailable sinceDec. 1, 2022AvailabilityAcademic Institutions and Nonprofits only -
pPBO.ACT006
Plasmid#182716PurposeConstituitvely expressed CasRx crRNA cloning vector, truncated 3' terminator region, with eGFP for cloningDepositorInsertCasRx crRNA cloning backbone
UseCRISPRTagsGFP in cloning site of crRNA for easier screening…ExpressionBacterialMutationCatalytically deactivated R295A, H300A, R849A, H8…PromoterpJ23119 (TTGACAGCTAGCTCAGTCCTAGGTATAATACTAGT)Available sinceAug. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
Intron-Tagging-pX330-Cas9-mCherry
Plasmid#159742PurposeExpresses Cas9-2A-mCherry and a sgRNA excising EGFP flanked by a splice acceptor and a splice donor from the Intron-Tagging-EGFP-Donor plasmid.DepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertdonor plasmid targeting sgRNA
UseCRISPRExpressionMammalianPromoterU6Available sinceNov. 18, 2020AvailabilityAcademic Institutions and Nonprofits only -
pGP-CMV-NEW-fRGECO2
Plasmid#125248PurposeExpresses red fluorescent calcium sensor in mammalian cellsDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertfRGECO2
TagsNES signalExpressionMammalianPromoterCMVAvailable sinceNov. 25, 2019AvailabilityAcademic Institutions and Nonprofits only -
pSB137 - pL2_pSB90_pNOS::rLUC-I::tNOS_tOCS::fLUC-I::pSTR1
Plasmid#123194Purposebinary plant vector for transient dual luciferase (rLUC & fLUC with introns) expressionDepositorInsertpNOS::rLUC-I::tNOS tOCS::fLUC-I::pSTR1
UseLuciferaseExpressionPlantAvailable sinceMay 29, 2019AvailabilityAcademic Institutions and Nonprofits only -
pTO_Snf7_LAP
Plasmid#101851PurposeTet-inducible expression of Snf7 from S. cerevisiae with a C-terminal GFP and long linker (LAP tag), compatible with Flp-In recombination for stable integrationDepositorInsertSNF7 (SNF7 Budding Yeast)
UseGateway cloning, flp-frt recombination, tet-induc…TagsLocalization and Affinity Purification (LAP) tagExpressionBacterial and MammalianPromoterCMVAvailable sinceDec. 12, 2017AvailabilityAcademic Institutions and Nonprofits onlyCited by