We narrowed to 83,323 results for: MYC
-
Plasmid#53077Purposedestination vector with PIP2a-ECFP (plasma membrane marker) for tagged fluorescent protein (N-ter-EYFP) of plant geneDepositorTypeEmpty backboneUseSynthetic BiologyAvailable SinceJuly 18, 2014AvailabilityAcademic Institutions and Nonprofits only
-
pBullet-vac-n
Plasmid#53075Purposedestination vector with vacuole marker (gamma-TIP) - ECFP for tagged fluorescent protein (N-ter-EYFP) of plant geneDepositorTypeEmpty backboneUseSynthetic BiologyAvailable SinceJuly 18, 2014AvailabilityAcademic Institutions and Nonprofits only -
pYTRW11K_0S5
Plasmid#177282Purposegenomic integration of genes (inserted in I-SceI-site) via transposon Tn5 with SmRDepositorInsertPaadA-aadA
UseSynthetic Biology; Yeast expression, tn5 genomic …ExpressionBacterialAvailable SinceAug. 6, 2025AvailabilityAcademic Institutions and Nonprofits only -
pA-CBh.TP-CNOT7-V5H6.MCh.Puro
Plasmid#209946PurposeIn mammalian cells expresses TP fused to a CNOT7 with a V5H6 tag. Also expresses an mCherry fluorescent protein and puromycin resistance marker.DepositorInsertsCCR4-NOT transcription complex subunit 7 (CNOT7 Human)
mCherry fluorescent protein fused to puromycin resistance marker
TagsTP (MS2 coat protein) and V5 epitope with H6 tagExpressionMammalianPromoterCBh and CMVAvailable SinceJuly 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
pA-CBh.TP-CNOT6-V5H6.MCh.Puro
Plasmid#209944PurposeIn mammalian cells expresses TP fused to a CNOT6 with a V5H6 tag. Also expresses an mCherry fluorescent protein and puromycin resistance marker.DepositorInsertsCCR4-NOT transcription complex subunit 6 (CNOT6 Human)
mCherry fluorescent protein fused to puromycin resistance marker
TagsTP (MS2 coat protein) and V5 epitope with H6 tagExpressionMammalianPromoterCBh and CMVAvailable SinceJuly 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
pA-CBh.TP-CNOT6L-V5H6.MCh.Puro
Plasmid#209945PurposeIn mammalian cells expresses TP fused to a CNOT6L with a V5H6 tag. Also expresses an mCherry fluorescent protein and puromycin resistance marker.DepositorInsertsTagsTP (MS2 coat protein) and V5 epitope with H6 tagExpressionMammalianPromoterCBh and CMVAvailable SinceJuly 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
pWR63(YUM1)
Plasmid#203336Purposeepisomal Cas9 and YUM1-targeting sgRNA expression vector for S. stipitisDepositorInsertsTEF1 promoter (S. stipitis) (TEF1 S. stipitis (yeast))
coHPH
ACT1 terminator (S. stipitis)
CCW12 promoter (S. stipitis)
CaCas9
ADH2 terminator (S. stipitis)
ARS from S. stipitis chromosome 1
THD3 promoter (S. stipitis)
tRNA-sgRNA(SapI)-HDV
ADH1 terminator (S. stipitis)
YUM1-targeting sequence
UseCRISPRExpressionYeastAvailable SinceJune 25, 2024AvailabilityAcademic Institutions and Nonprofits only -
pWR63
Plasmid#203331Purposeepisomal Cas9 and sgRNA expression vector without sgRNA for S. stipitisDepositorInsertsTEF1 promoter (S. stipitis) (TEF1 S. stipitis (yeast))
coHPH
ACT1 terminator (S. stipitis)
CCW12 promoter (S. stipitis)
CaCas9
ADH2 terminator (S. stipitis)
ARS from S. stipitis chromosome 1
THD3 promoter (S. stipitis)
tRNA-sgRNA(SapI)-HDV
ADH1 terminator (S. stipitis)
UseCRISPRExpressionYeastAvailable SinceJune 25, 2024AvailabilityAcademic Institutions and Nonprofits only -
pROS_phleo-Tps1/Gsy2
Plasmid#196612PurposeEncoding guide RNAs for the knock out of TPS1 and GSY2 genesDepositorAvailable SinceMarch 23, 2023AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-mCherry-mCherry-FLARE-CKAR
Plasmid#123345PurposeRed-fluorescent homoFRET/anisotropy-based biosensor for monitoring Protein Kinase C activity.DepositorInsertmCherry-mCherry-FLARE-CKAR
Tags6xHIS, T7 tag (gene 10 leader), Xpress (TM) tag, …ExpressionMammalianPromoterCMVAvailable SinceJuly 28, 2020AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-Cerulean3-Cerulean3-FLARE-AKAR
Plasmid#123335PurposeCyan-fluorescent homoFRET/anisotropy-based biosensor for monitoring Protein Kinase A activity.DepositorInsertCerulean3-Cerulean3-FLARE-AKAR
Tags6xHIS, Cerulean3, T7 tag (gene 10 leader), and Xp…ExpressionMammalianPromoterCMVAvailable SinceJuly 28, 2020AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-SAP155c
Plasmid#87390PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting SAP155c sequence ATGAAAGACAACTATAGGGC in yeast chromosome 6DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting SAP155c
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-ARS607c
Plasmid#87388PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS607c sequence CTATTTTTGCTTTCTGCACA in yeast chromosome 6.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS607c
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-SAP155b
Plasmid#87389PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting SAP155b sequence GGTTTTCATACTGGGGCCGC in yeast chromosome 6DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting SAP155b
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-ARS805a
Plasmid#87393PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS805a sequence TTATTTGAATGATATTTAGT in yeast chromosome 8.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS805a
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-ARS1206a
Plasmid#87398PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS1206a sequence CGAACATTTTTCCATGCGCT in yeast chromosome 12.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS1206a
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-RDS1a
Plasmid#87385PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting RDS1a sequence ATTCAATACGAAATGTGTGC in yeast chromosome 3DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting RDS1a
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
pBullet-cyt-n
Plasmid#53065Purposedestination vector with cytosol marker (ECFP) for tagged fluorescent protein (N-ter-EYFP) of plant geneDepositorTypeEmpty backboneUseSynthetic BiologyTagsECFP and EYFPAvailable SinceJuly 18, 2014AvailabilityAcademic Institutions and Nonprofits only -
pBullet-er-n
Plasmid#53067Purposedestination vector with WAK2 (29 aa)-ECFP- ER marker (HDEL) for tagged fluorescent protein (N-ter-EYFP) of plant geneDepositorTypeEmpty backboneUseSynthetic BiologyTagsECFP and EYFPAvailable SinceJuly 18, 2014AvailabilityAcademic Institutions and Nonprofits only -
pBullet-tgn-n
Plasmid#53071Purposedestination vector with ECFP-trans golgi network marker (VTI12) for tagged fluorescent protein (N-ter-EYFP) of plant geneDepositorTypeEmpty backboneUseSynthetic BiologyAvailable SinceJuly 18, 2014AvailabilityAcademic Institutions and Nonprofits only