We narrowed to 31,494 results for: ica
-
Plasmid#221575PurposePlasmid containing the Insert 3 to be assembled in POC1430 using the site-selective methylation protection approachDepositorInsertDNA fragment flanked by methylation-protectable BsaI sites and containing one always-methylable internal BsaI site
UseSynthetic BiologyAvailable SinceJune 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
POC1429
Plasmid#221576PurposePlasmid containing the Insert 4 to be assembled in POC1430 using the site-selective methylation protection approachDepositorInsertDNA fragment flanked by methylation-protectable BsaI sites and containing one always-methylable internal BsaI site
UseSynthetic BiologyAvailable SinceJune 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pSEVA63_sgRNA-B0_M13ps
Plasmid#231421PurposeM13 phagemid constitutively expressing sgRNA-B0. sgRNA-B0 is a dummy 20-nt sequence, containing a Golden Gate cloning site (BsaI). (A gift of the Jaramillo Lab, where it is called PAJ552.)DepositorInsertsgRNA-B0
UseSynthetic BiologyAvailable SinceJune 9, 2025AvailabilityAcademic Institutions and Nonprofits only -
P-Bf-fusA2
Plasmid#235658PurposeReports Cur activity in Bacteroides fragilisDepositorInsertBacteroides fragilis fusA2 promoter
MutationThe B. thetaiotaomicron fusA2 promoter lacking &q…Available SinceJune 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
pHK401
Plasmid#235482PurposeRepression of gene VIII by Plux/tet hybrid promoterDepositorInsertphage M13 geneVIII, cI repressor
ExpressionBacterialAvailable SinceMay 27, 2025AvailabilityAcademic Institutions and Nonprofits only -
pHK201
Plasmid#235481PurposeRepression of gene VIII by Ptac promoterDepositorInsertphage M13 geneVIII, cI repressor
ExpressionBacterialAvailable SinceMay 27, 2025AvailabilityAcademic Institutions and Nonprofits only -
pHK328
Plasmid#235479PurposeInducible gene VIII by Pbad/lac hybrid promoterDepositorInsertphage M13 geneVIII
ExpressionBacterialAvailable SinceMay 27, 2025AvailabilityAcademic Institutions and Nonprofits only -
pHK318
Plasmid#235478PurposeInducible gene VIII by Plux/tet hybrid promoterDepositorInsertphage M13 geneVIII
ExpressionBacterialAvailable SinceMay 27, 2025AvailabilityAcademic Institutions and Nonprofits only -
pHK009
Plasmid#235459PurposeNOR gate receiver with bs for sgRNA2 and sgRNA3DepositorInsertNOR gate
UseSynthetic BiologyAvailable SinceMay 27, 2025AvailabilityAcademic Institutions and Nonprofits only -
BtARR2 long (1-393)
Plasmid#236270PurposeBacterial expression of bovine arrestin-2 long isoform (1-393) Q394StopDepositorAvailable SinceMay 22, 2025AvailabilityAcademic Institutions and Nonprofits only -
BtARR2 long (1-382)
Plasmid#236269PurposeBacterial expression of bovine arrestin-2 long isoform (1-382) D383StopDepositorAvailable SinceMay 22, 2025AvailabilityAcademic Institutions and Nonprofits only -
pHK506.4
Plasmid#235455PurposeBUF/YES gate receiver with bs for sgRNA2DepositorInsertYES/BUF gate
UseSynthetic BiologyAvailable SinceMay 19, 2025AvailabilityAcademic Institutions and Nonprofits only -
pHK506.5
Plasmid#235456PurposeBUF/YES gate receiver with bs for sgRNA3DepositorInsertYES/BUF gate
UseSynthetic BiologyAvailable SinceMay 19, 2025AvailabilityAcademic Institutions and Nonprofits only -
pHK507
Plasmid#235457PurposeOR/NAND gate receiver with bs for sgRNA2 and sgRNA3DepositorInsertOR gate
UseSynthetic BiologyAvailable SinceMay 19, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV_mutCKAR3
Plasmid#238414PurposeAAV construct with CKAR3 mutant expression under a human synapsin promotor and WPRE3 translation enhancer.DepositorInsertphosphorylation deficient mutant of CKAR3 (T to A)
UseAAVExpressionMammalianAvailable SinceMay 14, 2025AvailabilityAcademic Institutions and Nonprofits only -
BtARR2 short
Plasmid#236267PurposeBacterial expression of bovine arrestin-2 short isoformDepositorAvailable SinceMay 12, 2025AvailabilityAcademic Institutions and Nonprofits only -
pYihI-C-term K-R
Plasmid#233092PurposeExpression of GST-YihI with C-term lysines (K) mutated to arginine (R)DepositorInsertGST-YihI with C-term lysines (K) mutated to arginine (R)
TagsGSTExpressionBacterialMutationC-term lysines (K) mutated to arginine (R)Available SinceMay 12, 2025AvailabilityIndustry, Academic Institutions, and Nonprofits -
pYihI-N-term K-R
Plasmid#233091PurposeExpression of GST-YihI with N-term lysines (K) mutated to arginine (R)DepositorInsertYihI with N-term lysines (K) mutated to arginine (R)
TagsGSTExpressionBacterialMutationN-terminal lysine residues mutated to arginineAvailable SinceMay 12, 2025AvailabilityIndustry, Academic Institutions, and Nonprofits -
pRnr-S1BD
Plasmid#232580PurposeExpression of the Rnr S1 and basic domains (residues 1930 to 2442) as a GST-fusion.DepositorInsertRnr S1 + basic domain (residues 1930 to 2442)
TagsGSTExpressionBacterialAvailable SinceMay 12, 2025AvailabilityIndustry, Academic Institutions, and Nonprofits -
pRnr-ND
Plasmid#232579PurposeExpression of the Rnr nuclease domain (residues 649 to 1929) as a GST-fusion.DepositorInsertRnr nuclease domain (residues 649 to 1929)
TagsGSTExpressionBacterialAvailable SinceMay 12, 2025AvailabilityIndustry, Academic Institutions, and Nonprofits -
pRnr-CSD
Plasmid#232578PurposeExpression of the Rnr cold shock domains I and II (residues 1 to 648) as a GST-fusion.DepositorInsertRnr cold shock domains I and II (residues 1 to 648)
TagsGSTExpressionBacterialAvailable SinceMay 12, 2025AvailabilityIndustry, Academic Institutions, and Nonprofits -
pHK326
Plasmid#235475PurposeInducible gene VIII by Ptac promoterDepositorInsertphage M13 geneVIII
ExpressionBacterialAvailable SinceMay 9, 2025AvailabilityAcademic Institutions and Nonprofits only -
pHK346
Plasmid#235477PurposeInducible gene VIII by Pbad promoterDepositorInsertphage M13 geneVIII
ExpressionBacterialAvailable SinceMay 9, 2025AvailabilityAcademic Institutions and Nonprofits only -
pHK336
Plasmid#235476PurposeInducible gene VIII by Plux promoterDepositorInsertphage M13 geneVIII
ExpressionBacterialAvailable SinceMay 9, 2025AvailabilityAcademic Institutions and Nonprofits only -
pHK-cinI
Plasmid#235486PurposeInducible gene cinI for OC14-HSL production by Ptac promoterDepositorInsertcinI
ExpressionBacterialAvailable SinceMay 9, 2025AvailabilityAcademic Institutions and Nonprofits only -
pYihI-N-term S-A
Plasmid#233096PurposeExpression of GST-YihI with N-term serines (S) mutated to alanine (A)DepositorInsertYihI with N-term serines (S) mutated to alanine (A)
TagsGSTExpressionBacterialMutationN-term serines (S) mutated to alanine (A)Available SinceMay 7, 2025AvailabilityIndustry, Academic Institutions, and Nonprofits -
ADEPT-pTarget-tetR
Plasmid#238043PurposeModified ADEPT-pCas9 with sfGFP under TtrB promoter for tetrathionate (TTR) sensing.DepositorInsertsfGFP
UseSynthetic BiologyPromoterttrBAvailable SinceMay 6, 2025AvailabilityAcademic Institutions and Nonprofits only -
RNF168 C-terminal sgRNA
Plasmid#207100PurposepX330 based plasmid for expression of Cas9 and the GAGATGCACAAAGTAAGGCC sgRNA to target the RNF168 locus.DepositorInsertGAGATGCACAAAGTAAGGCC
ExpressionMammalianPromoterCMV and U6Available SinceMay 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
RIF C-terminal sgRNA
Plasmid#207096PurposepX330 based plasmid for expression of Cas9 and the AATACTAAATAGAATTTTCA sgRNA to target the RIF1 locus.DepositorInsertAATACTAAATAGAATTTTCA
ExpressionMammalianPromoterCMV and U6Available SinceMay 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
REV7 C-terminal sgRNA
Plasmid#207095PurposepX330 based plasmid for expression of Cas9 and the GCTCATAAAGGCAGCTGAGG sgRNA to target the REV7 locus.DepositorInsertGCTCATAAAGGCAGCTGAGG
ExpressionMammalianPromoterCMV and U6Available SinceMay 1, 2025AvailabilityAcademic Institutions and Nonprofits only