We narrowed to 13,228 results for: sequence
-
Plasmid#61000PurposeT7-transcription template for Tte mRNA used for in vitro translationDepositorInsertTTE1564 transcript
UseUnspecifiedPromoterT7Available SinceJan. 20, 2016AvailabilityAcademic Institutions and Nonprofits only -
p201N 1509
Plasmid#55768PurposeContains soybean miRNA miR1509 recognition sequence (CAACCTTGATTTCCTTGATTAA) to produce siRNAs from 3' target sequences and induce RNA silencingDepositorTypeEmpty backboneUseRNAiPromoterGmUbiAvailable SinceSept. 8, 2014AvailabilityIndustry, Academic Institutions, and Nonprofits -
pFF19H
Plasmid#49783Purposeexpresses hygromycin resistance gene in plant cellsDepositorInsertHPH
UsePlant expressionPromoterCaMV 35SAvailable SinceJuly 10, 2014AvailabilityAcademic Institutions and Nonprofits only -
p64-101
Plasmid#25911DepositorInsertIg germline gamma-1 switch region alpha
ExpressionBacterialAvailable SinceAug. 11, 2010AvailabilityAcademic Institutions and Nonprofits only -
-
sCAG-DIO-oScarlet3
Plasmid#247721PurposeUsed for AAV1 tracing experiment.DepositorInsertoScarlet3
ExpressionMammalianAvailable SinceDec. 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
EK0716 SFFV-mCherry-SGc(s70587.os18)cSG-EGFP-(3xMS2) (FLP-IN)
Plasmid#247271PurposemodulADAR sensor against sythetic target transcript (35nt GluR-B stemloop)DepositorInsertmCherry-s70587.os18-EGFP
ExpressionMammalianMutationWTPromoterSFFVAvailable SinceOct. 27, 2025AvailabilityAcademic Institutions and Nonprofits only -
NSK477 SFFV-mCherry-SGc(Smn2ex7.os13-72bp.lowBG.16bp loop)cSG-EGFP-(3xMS2) (FLP-IN)
Plasmid#247291PurposeLow baseline modulADAR sensor for SMN exon 7DepositorInsertmCherry-Smn2ex7.os13-72bp.lowBG.16bp loop-EGFP
ExpressionMammalianMutationWTPromoterSFFVAvailable SinceOct. 27, 2025AvailabilityAcademic Institutions and Nonprofits only -
EK0718 SFFV-mCherry-SGc(s70587.os20)cSG-EGFP-(3xMS2) (FLP-IN)
Plasmid#247273PurposemodulADAR sensor against sythetic target transcript (36nt GABRA3 stem-loop)DepositorInsertmCherry-s70587.os20-EGFP
ExpressionMammalianMutationWTPromoterSFFVAvailable SinceOct. 27, 2025AvailabilityAcademic Institutions and Nonprofits only -
EK0717 SFFV-mCherry-SGc(s70587.os19)cSG-EGFP-(3xMS2) (FLP-IN)
Plasmid#247272PurposemodulADAR sensor against sythetic target transcript (41nt GluR-B stemloop)DepositorInsertmCherry-s70587.os19-EGFP
ExpressionMammalianMutationWTPromoterSFFVAvailable SinceOct. 27, 2025AvailabilityAcademic Institutions and Nonprofits only -
POC1553
Plasmid#238470PurposepMOBC360_VL: Vector Left (VL) of the set (Chloramphenicol R) to be methylated by the M.Osp807II BsaI-associated switch methylase. Used for the assembly using the methylation protection approachDepositorTypeEmpty backboneUseSynthetic BiologyAvailable SinceJuly 24, 2025AvailabilityAcademic Institutions and Nonprofits only -
POC1554
Plasmid#238471PurposepMOBC360_VR: Vector Right (VR) of the set (Chloramphenicol R) to be methylated by the M.Osp807II BsaI-associated switch methylase. Used for the assembly using the methylation protection approachDepositorTypeEmpty backboneUseSynthetic BiologyAvailable SinceJune 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
POC1358
Plasmid#236103PurposeAssembled plasmid containing four inserts (from POC1343, POC1344, POC1345 and POC1346) assembled in POC1355DepositorInsertDNA fragment flanked by BsaI sites
ExpressionBacterialAvailable SinceJune 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
POC1525
Plasmid#226496PurposepMOBC360_VM: Vector Middle (VM) of the set (Chloramphenicol R) to be methylated by the M.Osp807II BsaI-associated switch methylase. Used for the assembly using the methylation protection approachDepositorTypeEmpty backboneUseSynthetic BiologyAvailable SinceJune 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
POC1551
Plasmid#226498PurposepMOBK360_StandVKL: Standard Vector (Kanamycin R) to be methylated by the M.Osp807II BsaI-associated switch methylase. Used for the assembly using the methylation protectionDepositorTypeEmpty backboneUseSynthetic BiologyAvailable SinceJune 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
POC1552
Plasmid#226499PurposepMOBC360_StandVC: Standard Vector (Chloramphenicol R) to be methylated by the M.Osp807II BsaI-associated switch methylase. Used for the assembly using the methylation protectionDepositorTypeEmpty backboneUseSynthetic BiologyAvailable SinceJune 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
POC1520
Plasmid#221581PurposepMOBK360_VR: Vector Right (VR) of the set (Kanamycin R) to be methylated by the M.Osp807II BsaI-associated switch methylase. Used for the assembly using the methylation protection approachDepositorTypeEmpty backboneUseSynthetic BiologyAvailable SinceJune 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
POC1355
Plasmid#221572PurposeAssembly vector designed to be methylated by the M.Osp807II BsaI-associated switch methylase and for the assembly of inserts 1, 2, 3 and 4 from POC1343, POC1344, POC1345 and POC1346; respectivelyDepositorTypeEmpty backboneUseSynthetic BiologyAvailable SinceJune 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
POC1430
Plasmid#221577PurposeAssembly vector designed to be methylated by the M.Osp807II BsaI-associated switch methylase and for the assembly of inserts 1, 2, 3 and 4 from POC1426, POC1427, POC1428 and POC1429; respectivelyDepositorTypeEmpty backboneUseSynthetic BiologyAvailable SinceJune 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
POC1518
Plasmid#221579PurposepMOBK360_VL: Vector Left (VL) of the set (Kanamycin R) to be methylated by the M.Osp807II BsaI-associated switch methylase. Used for the assembly using the methylation protection approachDepositorTypeEmpty backboneUseSynthetic BiologyAvailable SinceJune 10, 2025AvailabilityAcademic Institutions and Nonprofits only