We narrowed to 28,934 results for: Tat
-
Plasmid#221086PurposeFAP insert for N-terminally tagging genes of interest (original FAP + 2xMYC tag)DepositorTypeEmpty backboneExpressionYeastAvailable SinceMarch 11, 2025AvailabilityAcademic Institutions and Nonprofits only
-
pRS415-TEF1pr-CFAPorig
Plasmid#221087PurposeFAP insert for C-terminally tagging genes of interest (original FAP + 2xMYC tag)DepositorTypeEmpty backboneExpressionYeastAvailable SinceMarch 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pMZ103-rbs1-m1
Plasmid#204463PurposeThis is a biosensor with improved specificity to 3OC12-HSL, containing LasR A127N mutation.DepositorInsertsUseSynthetic BiologyMutationLasR A127N mutationPromoterIn an operon and PLasAvailable SinceMarch 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
pMZ103-rbs1-m2
Plasmid#204464PurposeThis is a biosensor with improved specificity to 3OC12-HSL, containing LasR L128C mutation.DepositorInsertsUseSynthetic BiologyMutationLasR L128C mutationPromoterIn an operon and PLasAvailable SinceMarch 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
pSEVA47_dCas9-GFP_AAN_4
Plasmid#231415PurposeThis AND-AND-NOT-gate plasmid expresses dCas9 from a constitutive promoter. Its sgRNAs X & Y are repressible by sgRNAs A & B, respectively. Its GFP gene is repressible by any of sgRNAs X, Y, and C.DepositorInsertsdCas9
GFP
sgRNA-X
sgRNA-Y
UseSynthetic BiologyAvailable SinceFeb. 19, 2025AvailabilityAcademic Institutions and Nonprofits only -
AA498
Plasmid#231119PurposeFragmid fragment: (guide cassette) ABE activity-based selection CD274 positive controlDepositorInsertsgCD274 + ABE splice-targeting sgRNA
UseCRISPRExpressionBacterialAvailable SinceJan. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
AA505
Plasmid#231120PurposeFragmid fragment: (guide cassette) CBE activity-based selection CD274 positive controlDepositorInsertsgCD274 + CBE splice-targeting sgRNA
UseCRISPRExpressionBacterialAvailable SinceJan. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
Halo-ATG2A HRD
Plasmid#207540PurposeHomologous recombination donor to integrate a 3xFLAG-HaloTag at the endogenous ATG2A locus in human cellsDepositorInsertHaloTag flanked by human ATG2A locus sequences
TagsHaloTagExpressionMammalianPromoterEndogenousAvailable SinceJan. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
GB4653
Plasmid#215267PurposeTU for the constitutive expression of the flippase (FLP) recombinase with a nopaline synthase (Nos) promoterDepositorInsertpNos:FLP:tNos
UseSynthetic BiologyMutationBsaI and BsmBI sites removedAvailable SinceJan. 15, 2025AvailabilityAcademic Institutions and Nonprofits only -
GB4829
Plasmid#215275PurposeTU for the constitutive expression of the N. nambi NPGA gene under the P35S promoter and the TNOS terminatorDepositorInsertP35S:NPGA:TNOS
UseSynthetic BiologyMutationBsaI and BsmBI sites removedAvailable SinceJan. 15, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAM227
Plasmid#226650PurposeMSS-His6-UFD1LDepositorAvailable SinceOct. 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
pML107-PMR1
Plasmid#226264PurposePlasmid expressing Cas9 and gRNA ACATGACCGTATCTAAACTT which targets the PMR1 geneDepositorAvailable SinceOct. 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
pBWB507
Plasmid#209325Purposep15A-tetR-tet-ME-RBS-mRFP-ME-U1-Barcode-U2-dbI terminator-oriT-Cm. Plasmid backbone for fragment expression.DepositorInsertmRFP
ExpressionBacterialPromotertetAvailable SinceOct. 15, 2024AvailabilityAcademic Institutions and Nonprofits only -
GB3774
Plasmid#215247PurposeCDS of CPH from N. nambi codon optimized for N.benthamiana. This gene is the final step and recycling of the bioluminiscente pathwayDepositorInsertCPH
UseSynthetic BiologyMutationBsaI and BsmBI sites removedAvailable SinceOct. 1, 2024AvailabilityAcademic Institutions and Nonprofits only -
GB4807
Plasmid#215273PurposeModule for the expressino of the N. nambi HISPS gene under the PNOS promoter and the constitutive expression of EGFP and p19.DepositorInsertPNOS:HISPS-SF-EGFP-p19
UseSynthetic BiologyMutationBsaI and BsmBI sites removedAvailable SinceOct. 1, 2024AvailabilityAcademic Institutions and Nonprofits only -
GB4808
Plasmid#215274PurposeModule for the expressino of the N. nambi HISPS gene under the P35S promoter and the constitutive expression of EGFP and p19.DepositorInsertP35S:HISPS-SF-EGFP-p19
UseSynthetic BiologyMutationBsaI and BsmBI sites removedAvailable SinceOct. 1, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCI-SMN2-inclusion-GLuc
Plasmid#218671PurposeAlternative splicing signaling: signal increased with Ex7 inclusion increasingDepositorInsertSMN2 (SMN2 )
ExpressionMammalianAvailable SinceSept. 9, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLenti6.3-Nm2Cas9-BlastR
Plasmid#220980PurposeExpresses human codon-optimized Nm2Cas9DepositorInsertNm2Cas9
UseCRISPR and LentiviralExpressionMammalianAvailable SinceAug. 7, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLenti6.3-CjCas9-BlastR
Plasmid#220979PurposeExpresses human codon-optimized CjCas9DepositorInsertCjCas9
UseCRISPR and LentiviralExpressionMammalianAvailable SinceAug. 7, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLenti6.3-St1Cas9-BlastR
Plasmid#220976PurposeExpresses human codon-optimized St1Cas9DepositorInsertSt1Cas9
UseCRISPR and LentiviralExpressionMammalianAvailable SinceAug. 7, 2024AvailabilityAcademic Institutions and Nonprofits only