We narrowed to 9,680 results for: pho
-
Plasmid#232578PurposeExpression of the Rnr cold shock domains I and II (residues 1 to 648) as a GST-fusion.DepositorInsertRnr cold shock domains I and II (residues 1 to 648)
TagsGSTExpressionBacterialAvailable SinceMay 12, 2025AvailabilityIndustry, Academic Institutions, and Nonprofits -
pYihI-All K-R
Plasmid#233094PurposeExpression of GST-YihI with all lysines (K) mutated to arginine (R)DepositorInsertGST-YihI with all lysines (K) mutated to arginine (R)
TagsGSTExpressionBacterialMutationGST-YihI with all lysines (K) mutated to arginine…Available SinceMay 9, 2025AvailabilityIndustry, Academic Institutions, and Nonprofits -
pYihI-N-term S-A
Plasmid#233096PurposeExpression of GST-YihI with N-term serines (S) mutated to alanine (A)DepositorInsertYihI with N-term serines (S) mutated to alanine (A)
TagsGSTExpressionBacterialMutationN-term serines (S) mutated to alanine (A)Available SinceMay 7, 2025AvailabilityIndustry, Academic Institutions, and Nonprofits -
pAX1_Z11 gpN:SpyTag
Plasmid#225196PurposeUsed for adding C-terminal SpyTag to the Plesiomonas ZOR0011 P2 phage major capsid proteinDepositorInsertgpN homology arms and SpyTag
ExpressionBacterialAvailable SinceApril 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAX1_HS∆tum
Plasmid#225198PurposeUsed to create a markerless deletion of the E. coli HS tum geneDepositorInserttum homology arms
ExpressionBacterialAvailable SinceApril 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAX1_HS_lexA(Ind-)
Plasmid#225199PurposeUsed to create a non-inducible lexA by introducing a G85D mutation in E. coli HSDepositorInsertlexA homology arms
ExpressionBacterialMutationlexA G85DAvailable SinceApril 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAX1_HS_gpN:SpyTag
Plasmid#225193PurposeUsed for adding C-terminal SpyTag to the E. coli HS P2 phage major capsid proteinDepositorInsertgpN homology arms and SpyTag
ExpressionBacterialAvailable SinceApril 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCAG-GPHN-FingR-mGold-CCR5TC
Plasmid#231784PurposeVisualization of inhibitory post-synapse using GPHN-FingR-mGoldDepositorInsertGPHN-FingR-mGold-CCR5TC
ExpressionMammalianPromoterActin promoter with CMV enhancerAvailable SinceMarch 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCAG-GPHN-FingR-mVenus-CCR5TC
Plasmid#231783PurposeVisualization of inhibitory post-synapse using GPHN-FingR-mVenusDepositorInsertGPHN-FingR-mVenus-CCR5TC
ExpressionMammalianPromoterActin promoter with CMV enhancerAvailable SinceMarch 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCAG-GPHN-FingR-mGold2t-CCR5TC
Plasmid#231786PurposeVisualization of inhibitory post-synapse using GPHN-FingR-mGold2tDepositorInsertGPHN-FingR-mGold2t-CCR5TC
ExpressionMammalianPromoterActin promoter with CMV enhancerAvailable SinceMarch 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCMV-mGold2s-Rab4a-C-7
Plasmid#231773PurposeVisualization of endosome in mammalian cells using mGold2sDepositorAvailable SinceFeb. 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pMRX-IP-hWIPI3-3×FLAG
Plasmid#215511PurposeExpresses FLAG tagged human WIPI3.DepositorInsertWD-repeat protein interacting with phosphoinositides 3 (WDR45B Human)
UseRetroviralTags3×FLAGExpressionMammalianAvailable SinceNov. 21, 2024AvailabilityAcademic Institutions and Nonprofits only -
2BT-His-TEV-cs-LC3b
Plasmid#197460PurposeBacterial Expression of human LC3bDepositorAvailable SinceNov. 7, 2024AvailabilityAcademic Institutions and Nonprofits only -
GFP-PODXL S481D
Plasmid#195224PurposeMammalian expression vector containing GFP tagged Podocalyxin. PKC phosphomimetic mutant.DepositorAvailable SinceSept. 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
pMx/ATP8B2-HA
Plasmid#209227PurposeMammalian expression of ATP8B2DepositorAvailable SinceSept. 3, 2024AvailabilityAcademic Institutions and Nonprofits only -
pMx/ATP8B2(E171Q)-HA
Plasmid#209254PurposeMammalian expression of ATP8B2 mutant E171QDepositorAvailable SinceSept. 3, 2024AvailabilityAcademic Institutions and Nonprofits only -
Tol2-U6.3-sgRNA-non-targeting-control -GFP
Plasmid#221844PurposeTol2 transposon expresses control non-targeting sgRNA from chick U6.3 promoter expresses GFP reporter from GAGC promoterDepositorInsertsEGFP
non-targeting control sgRNA- GCACTGCTACGATCTACACC
UseCRISPR; Tol2 transposon optimised for chick expre…ExpressionMammalianPromoterGACG and U6.3 chickAvailable SinceJuly 31, 2024AvailabilityAcademic Institutions and Nonprofits only -
pMRX-IP-hWIPI2B-3×FLAG
Plasmid#215510PurposeExpresses FLAG tagged human WIPI2B.DepositorInsertWD-repeat protein interacting with phosphoinositides 2B (WIPI2 Human)
UseRetroviralTags3×FLAGExpressionMammalianAvailable SinceMay 20, 2024AvailabilityAcademic Institutions and Nonprofits only -
TDP-43 mRuby K84ONBK
Plasmid#216226PurposeTDP-43 with a C-terminal mRuby tag and Lysine 84 in the NLS mutated to a TAG stop codon for amber codon suppression.DepositorInsertTransactive response DNA binding protein of 43 kDa (TARDBP Human)
ExpressionMammalianMutationLysine 84 mutated to a TAG stop codonPromoterCMV PromoterAvailable SinceApril 25, 2024AvailabilityAcademic Institutions and Nonprofits only -
pDonor-PRF1-Exon3
Plasmid#209075PurposeTargeting vector for the human PRF1 locus to replace exon 3 with repaired exon 3DepositorInsertPRF1-Exon3 HDRT (PRF1 Human)
UseCRISPRAvailable SinceMarch 15, 2024AvailabilityAcademic Institutions and Nonprofits only