We narrowed to 10,224 results for: yeast
-
Plasmid#229991PurposeCarries OsTIR1-t2a-mNG-mIAA7, used to insert TIR1 expressing construct into the C. neoformans genome.DepositorInsertOsTIR1
Tagst2a-mNeonGreen-mIAA7_optExpressionBacterial and YeastMutationF74GAvailable SinceMarch 26, 2025AvailabilityAcademic Institutions and Nonprofits only -
STK25
Plasmid#39075PurposeBacterial expression for structure determination; may not be full ORFDepositorAvailable SinceMarch 18, 2013AvailabilityAcademic Institutions and Nonprofits only -
LHP2691 - pET30-Ub-K63A
Plasmid#32179DepositorTagsHISExpressionBacterialMutationK63APromoterT7Available SinceSept. 27, 2011AvailabilityAcademic Institutions and Nonprofits only -
LHP2690 - pET30-Ub-K48A
Plasmid#32178DepositorTagsHISExpressionBacterialMutationK48APromoterT7Available SinceSept. 27, 2011AvailabilityAcademic Institutions and Nonprofits only -
pAG426-GAL-TAF15
Plasmid#181713PurposeGalactose inducible expression of TAF15DepositorInsertTAF15 (TAF15 Human)
ExpressionYeastAvailable SinceJune 14, 2024AvailabilityAcademic Institutions and Nonprofits only -
pET-24a-STE2
Plasmid#133430PurposeYeast STE2 coding sequence in vector for in vitro transcription and protein synthesis, with T7 promoter.DepositorInsertSTE2 (STE2 Budding Yeast)
ExpressionBacterialMutationBoth native Cys (C59S/C252A) have been mutated. S…Available SinceJan. 6, 2020AvailabilityAcademic Institutions and Nonprofits only -
pXP420 v2 (repaired Amp promoter)
Plasmid#86920PurposeShuttle vector to facilitate gene expression for metabolic engineering in S. cerevisiae. Contains TEF1 promoter and CYC1 terminator for insertion of gene of interest. Contains HIS3 selection marker.DepositorTypeEmpty backboneUseCre/LoxExpressionYeastPromoterTEF1Available SinceFeb. 22, 2017AvailabilityAcademic Institutions and Nonprofits only -
pJK369
Plasmid#73594PurposeEncodes Crepis alpina delta-12 fatty acid acetylenase (vFAD2) with C-terminal FLAG epitopeDepositorInsertdelta-12 fatty acid acetylenase
TagsFLAG tagExpressionYeastPromoterGAL10Available SinceFeb. 26, 2016AvailabilityAcademic Institutions and Nonprofits only -
P2802
Plasmid#248828PurposeAll repressors for the WTC847 system.DepositorInsertLexA-L7-hER(L387M), LexA-hER-adh1tail
ExpressionYeastMutationLexA-L7-hER: L387MPromoterpACT1 (LexA-L7-hER(L387M)), P7SulA.1(LexA-hER-adh…Available SinceJan. 15, 2026AvailabilityAcademic Institutions and Nonprofits only -
pML104-HygMx4-URA3-3
Plasmid#232886PurposePlasmid expressing Cas9 and gRNA GAAGTAACAAAGGAACCTAG which targets the URA3 gene.DepositorAvailable SinceFeb. 26, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML104-HygMx4-URA3-2
Plasmid#232885PurposePlasmid expressing Cas9 and gRNA TCGTACCACCAAGGAATTAC which targets the URA3 gene.DepositorAvailable SinceFeb. 26, 2025AvailabilityAcademic Institutions and Nonprofits only -
pRS313-rad53-5004
Plasmid#232902PurposePlasmid carrying the rad53-5004 allele with its native promoter and terminator.DepositorAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
YIplac211-Kar2-moxGFP2-HDEL
Plasmid#218970PurposeGene replacement plasmid to label S. cerevisiae Kar2 with moxGFP2DepositorAvailable SinceSept. 18, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAG426-GAL-Prepro-3x-Adan
Plasmid#181733PurposeGalactose inducible expression of Prepro-3x-AdanDepositorInsertPrepro-3x-Adan
ExpressionYeastAvailable SinceApril 26, 2024AvailabilityAcademic Institutions and Nonprofits only -
HCP1
Plasmid#166103PurposeThis plasmid encodes a Cas9 protein as well as a sgRNA that targets Msn2, which will create a double strand break and allow C-terminus tagging via homologous recombination.DepositorAvailable SinceApril 14, 2021AvailabilityAcademic Institutions and Nonprofits only -
pJK138
Plasmid#73314PurposePas2p peroxisomal membrane targeting sequenceDepositorInsertPas2p (peroxisomal membrane targeting region)
TagsHis6 and c-mycExpressionYeastMutationencodes residues 1-42PromoterAOX1Available SinceFeb. 26, 2016AvailabilityAcademic Institutions and Nonprofits only -
brr2-R1107M pRS313
Plasmid#111417Purposebrr2-R1107M (endogenous promoter)DepositorInsertBRR2
ExpressionYeastMutationR1107M aa mutation (note, not an RP allele)AvailabilityAcademic Institutions and Nonprofits only -
DHC1-AID-Clover donor (Hygro)
Plasmid#158622PurposeDonor plasmid for tagging DHC1 with AID-CloverDepositorInsertDHC1 (DYNC1H1 Human)
UseCRISPR; Tagging donorAvailable SinceNov. 12, 2020AvailabilityAcademic Institutions and Nonprofits only -
pNK5785
Plasmid#219753PurposepGAP-like vector encoding mutant of Neonothopanus nambi luciferase nnLuz_v4 under control of GAP promoter, for yeast expressionDepositorInsertpGAP - nnLuz_v4 - tAOX
UseLuciferaseExpressionYeastAvailable SinceJuly 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
pNK5712
Plasmid#219752PurposepGAP-like vector encoding mutant of Neonothopanus nambi hispidin-3-hydroxylase nnH3H_v2 under control of GAP promoter, for yeast expressionDepositorInsertpGAP - nnH3H_v2 - tAOX
ExpressionYeastAvailable SinceJuly 12, 2024AvailabilityAcademic Institutions and Nonprofits only