We narrowed to 81,061 results for: myc
-
Plasmid#227505PurposeBackbone for CARGO cloning, with U6 promoter and gRNA scaffold, TagBFP, and Kanamycin resistenceDepositorTypeEmpty backboneUseCRISPRAvailable SinceMay 5, 2025AvailabilityAcademic Institutions and Nonprofits only
-
pYPQAT44
Plasmid#223416PurposeT-DNA vector for temperature tolerance LbCas12a-D156R based mutagenesis for monocot plants; TTTV PAM; LbCas12a-D156R and the crRNA were driven by separate ZmUbi1; Hygromycin for plants selection.DepositorInsertZmUbi-LbCas12a-D156R-ZmUbi-crRNA scaffold
UseCRISPRTagsNLSExpressionPlantAvailable SinceApril 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pYPQAT50
Plasmid#223422PurposeT-DNA vector for LbCas12a-RRV based mutagenesis for monocot plants; highly efficient including TTV PAM; LbCas12a-RRV and the crRNA was driven by separate ZmUbi1 promoter; Hygromycin for plants select.DepositorInsertZmUbi-LbCas12a-RRV-ZmUbi-crRNA scaffold
UseCRISPRTagsNLSExpressionPlantAvailable SinceApril 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pYPQAT53
Plasmid#223425PurposeT-DNA vector for dLbCas12a-D156R mediated A to G base editing for monocot plants; TTTV PAM; LbCas12a-D156R-ABE and the crRNA were driven by separate ZmUbi1 promoter; Hygromycin for plants selection.DepositorInsertZmUbi-ecTadA8e-dLbCas12a-D156R-ZmUbi-crRNA scaffold
UseCRISPRTagsNLSExpressionPlantAvailable SinceApril 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pYPQAT54
Plasmid#223426PurposeT-DNA vector for dLbCas12a-D156R mediated A to G base editing for monocot plants; TTTV PAM; LbCas12a-D156R-ABE and the crRNA were driven by separate 2x35s promoter; Kanamycin for plants selection.DepositorInsert2x35s-ecTadA8e-dLbCas12a-D156R-2x35s-crRNA scaffold
UseCRISPRTagsNLSExpressionPlantAvailable SinceApril 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pYPQAT33
Plasmid#223405PurposeT-DNA vector for SpCas9-D10A based A-to-G base editing for dicot plants; NGG PAM; SpCas9D10A-ABE was driven by 2x35s and the sgRNA was driven by AtU3 promoter; Kanamycin for plants selection.DepositorInsert2x35s-ecTadA8e-SpCas9-D10A-AtU3-gRNA scaffold
UseCRISPRTags3x FLAG and NLSExpressionPlantAvailable SinceApril 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pYPQAT34
Plasmid#223406PurposeT-DNA vector for SpCas9-D10A based A-to-G base editing for monocot plants; NGG PAM; SpCas9D10A-ABE was driven by ZmUbi1 and the sgRNA was driven by OsU3 promoter; Hygromycin for plants selection.DepositorInsertZmUbi-ecTadA8e-SpCas9-D10A-OsU3-gRNA scaffold
UseCRISPRTags3x FLAG and NLSExpressionPlantAvailable SinceApril 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pYPQAT36
Plasmid#223408PurposeT-DNA vector for SpCas9-D10A based A-to-G base editing for monocot plants; NGG PAM; SpCas9D10A-ABE was driven by ZmUbi1 and the sgRNA was driven by ZmUbi1; Hygromycin for plants selection.DepositorInsertZmUbi-ecTadA8e-SpCas9-D10A-ZmUbi-gRNA scaffold-tRNA
UseCRISPRTags3x FLAG and NLSExpressionPlantAvailable SinceApril 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pYPQAT06
Plasmid#223378PurposeT-DNA vector for SpCas9 mediated mutagenesis for monocot plants; NGG PAM; Cas9 was driven by ZmUbi1 and the sgRNA was driven by ZmUbi1 promoter; Hygromycin for plants selection.DepositorInsertZmUbi-SpCas9-ZmUbi-gRNA scaffold-tRNA
UseCRISPRTags3x FLAG and NLSExpressionPlantAvailable SinceApril 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCRISPEY-Z3-Kan
Plasmid#232102PurposeYeast CEN plasmid for estradiol-inducible expression of CRISPR guide RNA and repair template for homologous recombination, with Z3 promoter and Z3EV transcription factor.DepositorTypeEmpty backboneUseCRISPRExpressionYeastAvailable SinceFeb. 25, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCRISPEY-Z3-Hyg
Plasmid#232101PurposeYeast CEN plasmid for estradiol-inducible expression of CRISPR guide RNA and repair template for homologous recombination, with Z3 promoter and Z3EV transcription factor.DepositorTypeEmpty backboneUseCRISPRExpressionYeastAvailable SinceFeb. 21, 2025AvailabilityAcademic Institutions and Nonprofits only -
pTBL3342 PB-PEmax-puro
Plasmid#226674PurposePiggyBac cargo vector encoding PEmax and puromycin resistance.DepositorInsertPEmax
UseCRISPRExpressionMammalianPromoterCAGAvailable SinceFeb. 21, 2025AvailabilityAcademic Institutions and Nonprofits only -
pJJB1559
Plasmid#218590PurposeExpress peroxisomal Idi1p, Erg20(F96W,N127W)p, and GESp to convert IPP to geraniol with cytosolic Erg20 homodimerDepositorInsertGES
TagsePTS1ExpressionYeastMutationErg20(F96W, N127W), Erg20-Erg20 synthetic homodim…Available SinceOct. 4, 2024AvailabilityAcademic Institutions and Nonprofits only -
pET-28a (+)-Gal4-p53
Plasmid#171076PurposeExpresses Gal4-p53 fusion protein in bacteriaDepositorInsertGal4 DBD (NEWENTRY Budding Yeast)
TagsHis and p53(1-85)ExpressionBacterialPromoterT7 promoterAvailable SinceJuly 19, 2024AvailabilityAcademic Institutions and Nonprofits only -
-
-
-
BS-ZJLEU-PTEF1-GFP
Plasmid#207018PurposeOver-expression of GFP under TEF1 promoter, use auxotrophic marker LEU2(Saccharomyces cerevisiae).DepositorInsertGFP
ExpressionYeastPromoterpTEF1Available SinceJune 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
PTPI1-Dsred-URA3
Plasmid#207017PurposeExpresses DsRed-Express 2 as a marker of cytosol, uses auxotrophic marker URA3(Saccharomyces cerevisiae).DepositorInsertDsRed-Express 2
ExpressionYeastPromoterpTPI1Available SinceJune 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
pMS18
Plasmid#215675PurposeCas9 + guide plasmid for inserting ChrI split hygromycinR landing padDepositorInserteef-1A.1p::Cas9 + U6p::GAAATCGCCGACTTGCGAGG
UseCRISPRExpressionWormAvailable SinceMarch 25, 2024AvailabilityAcademic Institutions and Nonprofits only