We narrowed to 10,605 results for: yeast
-
Plasmid#203512PurposeGateway-compatible destination vector for yeast expression with GAL10 promoter/6stop mutation/URA3 markerDepositorTypeEmpty backboneExpressionYeastAvailable SinceJuly 31, 2023AvailabilityAcademic Institutions and Nonprofits only
-
pTH734-2µ-RLuc/stopCFLuc
Plasmid#40609DepositorInsertsFirefly Luciferase (nonsense mutant)
Renilla luciferase
ExpressionYeastMutationAll codons of the original FLuc gene were exchang…PromoterADH1 and TDH3Available SinceOct. 30, 2012AvailabilityAcademic Institutions and Nonprofits only -
pESC-Leu-SopB(C460S)
Plasmid#183671PurposeInducible Salmonella Typhimurium SopB (catalytically inactive) for expression in yeastDepositorInsertsopB (sopB Salmonella enterica serovar Typhimurium)
ExpressionYeastMutationC460SPromoterGAL1Available SinceMay 3, 2022AvailabilityAcademic Institutions and Nonprofits only -
pDUAL-Pnmt1-Ost4-GFP-MTn
Plasmid#154369PurposeYeast expression of Ost4DepositorInsertOst4 (ost4 Fission Yeast)
ExpressionYeastAvailable SinceJuly 23, 2020AvailabilityAcademic Institutions and Nonprofits only -
pNIA-CEN-mVenus-FLAG-LANS1-Set2
Plasmid#122003PurposemVenus-FLAG-LANS-Set2: mVenus- and FLAG-tagged LANS1-Set2 for light control of Set2 localization in yeastDepositorInsertmVenus-FLAG-LANS1-Set2 (SET2 Budding Yeast)
UseSynthetic BiologyTagsmVenus-FLAGExpressionYeastMutationSet2 point mutations K538G, K539S, R549G, K550S, …PromoterADH1Available SinceJune 2, 2021AvailabilityAcademic Institutions and Nonprofits only -
3021_pETcon-SARS-CoV-2-RBD_K417N_E484K_N501Y
Plasmid#184406Purposeyeast surface display of the SARS-CoV-2 Beta variant RBDDepositorInsertSARS-CoV-2 Beta Spike receptor binding domain (RBD) (S SARS-CoV-2 virus)
TagsHA and c-MycExpressionYeastMutationK417N+E484K+N501YAvailable SinceMay 23, 2022AvailabilityAcademic Institutions and Nonprofits only -
pDUAL-P41nmt1-Nup124-GFP-MTn
Plasmid#154365PurposeYeast expression of Nup124DepositorAvailable SinceAug. 11, 2020AvailabilityAcademic Institutions and Nonprofits only -
pTH752-CEN-RLuc/min103maxCFLuc
Plasmid#38218DepositorInsertsFirefly Luciferase
Renilla luciferase
ExpressionYeastMutationThe first 103 codons of the original FLuc gene we…PromoterADH1 and TDH3 (=GPD)Available SinceOct. 22, 2012AvailabilityAcademic Institutions and Nonprofits only -
pTH751-CEN-RLuc/min53maxCFLuc
Plasmid#38217DepositorInsertsFirefly Luciferase
Renilla luciferase
ExpressionYeastMutationThe first 53 codons of the original FLuc gene wer…PromoterADH1 and TDH3 (=GPD)Available SinceOct. 22, 2012AvailabilityAcademic Institutions and Nonprofits only -
pACT-HAB1
Plasmid#241276PurposeYeast two hybrid vector expressing AD-HAB1DepositorAvailable SinceSept. 8, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-NET1
Plasmid#232893PurposePlasmid expressing Cas9 and gRNA GTGCCACTAATGGATCCATG which targets the NET1 gene.DepositorAvailable SinceApril 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-VRG4
Plasmid#232899PurposePlasmid expressing Cas9 and gRNA TCGCATAGCCCAGTATACGT which targets the VRG4 gene.DepositorAvailable SinceApril 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-SAM50
Plasmid#232895PurposePlasmid expressing Cas9 and gRNA AATAGTTTATGTAAGAACAG which targets the SAM50 gene.DepositorAvailable SinceApril 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML104-LEU2-3
Plasmid#232894PurposePlasmid expressing Cas9 and gRNA GTTCTTAACTAGGATCATGG which targets the RER2 gene.DepositorAvailable SinceFeb. 26, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML104-HIS3-3
Plasmid#232882PurposePlasmid expressing Cas9 and gRNA AAACCTTTTTACTCCACGCA which targets the HIS3 gene.DepositorAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML104-HIS3-2
Plasmid#232881PurposePlasmid expressing Cas9 and gRNA CCAAGTTCGACAACTGCGTA which targets the HIS3 gene.DepositorAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-ADE13
Plasmid#232887PurposePlasmid expressing Cas9 and gRNA GTAGCAGCAAAAGAAGACAA which targets the ADE13 gene.DepositorAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML104-LEU2-2
Plasmid#232883PurposePlasmid expressing Cas9 and gRNA GGTAGTGTTAGACCTGAACA which targets the LEU2 gene.DepositorAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pKG-GW2-NgBR
Plasmid#203165PurposeYeast expression vector for hNUS1DepositorAvailable SinceAug. 29, 2023AvailabilityAcademic Institutions and Nonprofits only -
pKG-GW2-NgBR R290H
Plasmid#203167PurposeYeast expression vector for hNUS1 R290HDepositorAvailable SinceAug. 29, 2023AvailabilityAcademic Institutions and Nonprofits only