We narrowed to 77,447 results for: Rest
-
Plasmid#205471PurposeLuciferase reporter for Alu Domain ActivityDepositorInsertMutant 2 GATD1 Alu Domain
UseLuciferase and RNAiMutationMutated the arms of the alu domain by adding ACAC…PromoterT7Available SinceJuly 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAG CMV C-HA Puro
Plasmid#237880PurposeEmpty mammalian expression plasmid for cloning C-terminally HA-tagged proteinsDepositorTypeEmpty backboneTagsHAExpressionMammalianPromoterCMVAvailable SinceJune 12, 2025AvailabilityIndustry, Academic Institutions, and Nonprofits -
Sc [Pol31 + Pol32]-pRS403/GAL
Plasmid#239199PurposeOvererxpress Sc Pol31 & Pol32 when integrated into yeast (S. cer)DepositorAvailable SinceJune 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
Ec holA(Y316A)-FLAG-pET(11a)(ACH-)
Plasmid#238346Purposeover-expresses C-terminal FLAG tagged E. coli delta (Y316A) in E. coliDepositorInsertC-terminal FLAG tagged E. coli delta (Y316A) (holA E. coli)
Tags3X FLAGExpressionBacterialMutationY316AAvailable SinceMay 14, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-KAE1
Plasmid#232891PurposePlasmid expressing Cas9 and gRNA GATGACAACTGAATGCAGAG which targets the KAE1 gene.DepositorAvailable SinceApril 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAG Lenti CMV EGFP-HA Puro
Plasmid#236082PurposeLentiviral backbone expressing C-terminally HA tagged EGFP, control for empty backbone 236080DepositorInsertEGFP
UseLentiviralTagsHAPromoterCMVAvailable SinceApril 25, 2025AvailabilityIndustry, Academic Institutions, and Nonprofits -
pAAV-Ef1a-Con/Fon-Synaptophysin-10xMyc-WPRE
Plasmid#237446PurposeIntersectional expression of Myc-tagged synaptophysin in the presence of Cre and FlpDepositorInsertCon/Fon-Synaptophysin-10xMyc
UseAAVExpressionMammalianPromoterEF1aAvailable SinceApril 25, 2025AvailabilityAcademic Institutions and Nonprofits only -
Ec holB-pET(11a)(ACH-)
Plasmid#237234Purposeover-express E. coli holB (Pol III delta prime subunit)DepositorInsertholB (delta prime) (holB E. coli)
ExpressionBacterialAvailable SinceApril 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSynI-EGFP-WPRE-hGH poly(A) (Alex_02)
Plasmid#71651PurposeAAV expression of EGFP in human and mouse neuronsDepositorInsertEGFP
UseAAVExpressionMammalianAvailable SinceApril 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
TRE-FRT-MCS-WPRE-SV40 - GCH27
Plasmid#230828PurposeAAV cloning vector for Flpo-dependent expression under the TRE promoter.DepositorTypeEmpty backboneUseAAV; Cloning vector, flp/frtAvailable SinceMarch 26, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-ARB1
Plasmid#232888PurposePlasmid expressing Cas9 and gRNA CAAAAACTAACTGCTTACGG which targets the ARB1 gene.DepositorAvailable SinceMarch 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pGL3_THADA_pos1toneg0
Plasmid#232388PurposeTHADA enhancer, one sensitizing element made into buffering CoordinatorDepositorInsertTHADA (THADA Human)
UseLuciferaseMutationTHADA enhancer, one sensitizing element made into…Available SinceFeb. 27, 2025AvailabilityAcademic Institutions and Nonprofits only -
pGL3_MSR1_bothneg0scramble
Plasmid#232383PurposeMSR1 enhancer, both buffering Coordinators scrambledDepositorAvailable SinceFeb. 27, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-RER2
Plasmid#232884PurposePlasmid expressing Cas9 and gRNA AGAATCGCATCTCTACACGG which targets the RER2 gene.DepositorAvailable SinceFeb. 26, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML104-LEU2-3
Plasmid#232894PurposePlasmid expressing Cas9 and gRNA GTTCTTAACTAGGATCATGG which targets the RER2 gene.DepositorAvailable SinceFeb. 26, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-AVO1
Plasmid#232889PurposePlasmid expressing Cas9 and gRNA AATGATGACGACCATACCAG which targets the AVO1 gene.DepositorAvailable SinceFeb. 21, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-YFR054C
Plasmid#232900PurposePlasmid expressing Cas9 and gRNA GCTCAAAGAAACAATTAGAG which targets the YFR054C gene.DepositorAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-SRP14
Plasmid#232896PurposePlasmid expressing Cas9 and gRNA GAAAACAAAATGCTCAACAG which targets the SRP14 gene.DepositorAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-TLG1
Plasmid#232897PurposePlasmid expressing Cas9 and gRNA GATGAAAACGAAGACGTGAG which targets the TLG1 gene.DepositorAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-VHT1
Plasmid#232898PurposePlasmid expressing Cas9 and gRNA TGCGGCCACACTGAAATACG which targets the VHT1 gene.DepositorAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML104-LEU2-2
Plasmid#232883PurposePlasmid expressing Cas9 and gRNA GGTAGTGTTAGACCTGAACA which targets the LEU2 gene.DepositorAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-INO80
Plasmid#232890PurposePlasmid expressing Cas9 and gRNA GGAAGTAGAATCATTCGTAG which targets the INO80 gene.DepositorAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
AAV-hSyn-PiGM-Iq(535/81, eGFP)
Plasmid#221612PurposeAAV encoding PiGM-Iq with minimal RGS10 domain, CRY2 (535 amino acid version), CIB1 (81 amino acid version).DepositorInsertPiGM-Iq (535/81,eGFP)
UseAAVMutationRGS2 1-53 truncationPromoterHuman SynapsinAvailable SinceFeb. 12, 2025AvailabilityAcademic Institutions and Nonprofits only -
pGL3_THADA_alltoneg0
Plasmid#232372PurposeTHADA enhancer, all sensitizing elements made into buffering CoordinatorDepositorInsertTHADA (THADA Human)
UseLuciferaseMutationTHADA enhancer, all sensitizing elements made int…Available SinceFeb. 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
-
pPMS-2016
Plasmid#232290PurposeProtein ExpressionDepositorAvailable SinceFeb. 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
MSCV-IRES-tagBFP
Plasmid#219965Purposeexpress TagBFP in mammalian cellsDepositorInsertTagBFP
UseRetroviralExpressionMammalianAvailable SinceSept. 13, 2024AvailabilityAcademic Institutions and Nonprofits only -
pT7-35aaNSP1noMSA11-NSP5(io)
Plasmid#220827PurposeExpress the short Rotavirus SA11 NSP1 protein (35 amino acids) that lacks all methionines fused with the full-length recoded NSP5 proteinDepositorInsertRotavirus SA11 35aaNSP1noM-NSP5(io)
UseOtherMutationthe 35aa NSP1 lacks all MethioninesAvailable SinceSept. 3, 2024AvailabilityAcademic Institutions and Nonprofits only -
pT7-35aaNSP1SA11-P2A-NSP5(io)-GS-smURFP
Plasmid#220828PurposeExpress separately the short Rotavirus SA11 NSP1 protein (35 amino acids) and the full-length recoded NSP5 protein fused with GS-linker and smURFPDepositorInsertRotavirus SA11 35aaNSP1-P2A-NSP5(io)-GS-smURFP
UseOtherAvailable SinceSept. 3, 2024AvailabilityAcademic Institutions and Nonprofits only -
pT7-35aaNSP1noMSA11-NSP5(wt)
Plasmid#220826PurposeExpress the short Rotavirus SA11 NSP1 protein (35 amino acids) that lacks all methionines fused with the full-length SA11 NSP5 proteinDepositorInsertRotavirus SA11 35aaNSP1noM-NSP5(wt)
UseOtherMutationthe 35aa NSP1 lacks all MethioninesAvailable SinceAug. 30, 2024AvailabilityAcademic Institutions and Nonprofits only