We narrowed to 7,609 results for: Pol
-
Plasmid#203805PurposeLentiviral vector plasmid expressing mouse Llgl1 under the spleen focus-forming virus (SFFV) promoter and Emerald under the Ubiquitin C (UbC) promoterDepositorAvailable SinceJuly 24, 2023AvailabilityAcademic Institutions and Nonprofits only
-
pCAG-lox-inv[Talpha1-Dre-pA]-lox-Lyn-EGFP
Plasmid#196876PurposeNeuron-specific expression of LynGFP reporter. Used in combination with Talpha1-iCre-pA plasmidsDepositorInsertLynEGFP
UseCre/Lox; Dre/roxExpressionMammalianPromoterQuimeric CAGAvailable SinceMay 16, 2023AvailabilityAcademic Institutions and Nonprofits only -
pBactin-DIO-inv[roxSTOProx-ZsGreen-bGH]
Plasmid#196886PurposeDual Cre/Dre-dependent expression of ZsGreen. Used as Cre-Dre cotransfection reporterDepositorInsertroxSTOProx-ZsGreen-bGH
UseCre/Lox; Dre/roxExpressionMammalianPromoterChicken bactin (plus Chicken bactin intron)Available SinceMay 16, 2023AvailabilityAcademic Institutions and Nonprofits only -
pBetaActin-FKBP-Dync1h1motor
Plasmid#191332PurposeExpresses the dynein motor domain fused to the dimerization domain FKBP to recruit it to the plasma membrane by using the chemical dimerization system FKBP-FRBDepositorInsertFKBP-Dync1h1motor (Dync1h1 Mouse)
ExpressionMammalianMutationDYNC1H1 motor domain aa 1453-4644Available SinceMarch 15, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAP14
Plasmid#186262PurposewgaA (a.k.a expA1) and wgaB (a.k.a expA23), bicistronic, under light light responsive PEL222 promoter and EL222 under constitutively active LacIq promoterDepositorInsertsExpressionBacterialPromoterLacIq (CGAATGGTGCAAAACCTTTCGCGGTATGGCATGATAGCGCCC…Available SinceAug. 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCW57.1-GFP_mmu-miR-292b-3p_sponge
Plasmid#132622PurposeExpresses a TurboGFP transcript with test microRNA sponge for mmu-miR-292b-3p as 3'UTR; serves as template for other microRNA spongesDepositorInsertstop codon, mmu-miR-292b-3p sponge sequence and polyA signal
UseLentiviral; Doxycycline inducibleExpressionMammalianPromoterTREAvailable SinceAug. 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
pGEX-2T-TRX-C751-E3616S
Plasmid#182844Purposemutation E3616S (GAA/TCA), PCR product coding C-terminal residues 2976-3726 of TRX was inserted into modified pGEX-2T by Nde I-Nsi I sites. Expression in E. coli. by IPTG inductionDepositorAvailable SinceApril 21, 2022AvailabilityAcademic Institutions and Nonprofits only -
pGEX2T-TEV CHMP1B 186-199
Plasmid#108285PurposeExpresses residues 186-199 of CHMP1B with an N-terminal GST tag and a TEV cleavage site; Internal ID: WISP 09-283DepositorAvailable SinceApril 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
pGEX2T-TEV CHMP1B 144-178
Plasmid#108287PurposeExpresses residues 144-178 of CHMP1B with an N-terminal GST tag and a TEV cleavage site; Internal ID: WISP 09-281DepositorAvailable SinceApril 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
pT5T_Rev7_1-211_SA112_KVK_Rev3_1873-1898
Plasmid#105635PurposeExpresses mouse monomeric Rev7 and fragment of Rev3 protein (amino acids 1873-1898) from bicistronic plasmidDepositorExpressionBacterialMutationMutations: F11S, G12A, V132K, C133V, A135KAvailable SinceMarch 14, 2022AvailabilityAcademic Institutions and Nonprofits only -
pT5T_Rev7_1-211_SA112_KVK_Rev3_1989-2014
Plasmid#105637PurposeExpresses mouse monomeric Rev7 and fragment of Rev3 protein (amino acids 1989-2014) from bicistronic plasmidDepositorExpressionBacterialMutationMutations: F11S, G12A, V132K, C133V, A135KPromoterT7Available SinceMarch 14, 2022AvailabilityAcademic Institutions and Nonprofits only -
pFastBac1_GI.1_A37C-A44C
Plasmid#162582PurposeExpresses norovirus GI.1 VP1 protein with mutations A37C-A44C in Sf9 insect cellsDepositorInsertVP1 protein from human norovirus GI.1
ExpressionInsectMutationAlanine 37 changed to Cysteine and Alanine 44 cha…PromoterpolyhedringAvailable SinceMay 7, 2021AvailabilityAcademic Institutions and Nonprofits only -
CPH3566 (pDEST15_Spt6 1223-1451)
Plasmid#91814PurposeBacterial expression of residues 1223-1451 from S. cerevisiae Spt6DepositorInsertSPT6 (SPT6 Budding Yeast)
TagsGSTExpressionBacterialMutationdeleted residues 1-1222PromoterT7Available SinceMarch 11, 2021AvailabilityAcademic Institutions and Nonprofits only -
CPH1141 (pET151_Spt6 1247-1451)
Plasmid#91815PurposeBacterial expression of residues 1247-1451 from S. cerevisiae Spt6DepositorInsertSPT6 (SPT6 Budding Yeast)
Tags6xHisExpressionBacterialMutationdeleted residues 1-1246PromoterT7Available SinceMarch 11, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCJ220
Plasmid#162686PurposepET-21b(+) based plasmid for expression of MHETase from Ideonella sakaiensis 201-F6 (Genbank GAP38911.1), codon optimized for expression in E. coli K12, with C-terminal His tag, incorporating lid deletion (Gly251:Thr472) and C224W and C529S mutations from PETase active site.DepositorInsertMHETase from Ideonella sakaiensis 201-F6 (Genbank GAP38911.1) with lid deletion and C224W and C529S mutations
TagsHisExpressionBacterialMutationdeltaG251-T472, C224W, C529S; codon optimized for…PromoterT7/lacAvailable SinceJan. 7, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCJ221
Plasmid#162687PurposepET-21b(+) based plasmid for expression of MHETase from Ideonella sakaiensis 201-F6 (Genbank GAP38911.1), codon optimized for expression in E. coli K12, with C-terminal His tag, incorporating lid deletion (Gly251:Thr472) and C224H and C529F mutations from PETase active site.DepositorInsertMHETase from Ideonella sakaiensis 201-F6 (Genbank GAP38911.1), with lid deletion and C224H and C529F mutations
TagsHisExpressionBacterialMutationdeltaG251-T472, C224H, C529F; codon optimized for…PromoterT7/lacAvailable SinceJan. 7, 2021AvailabilityAcademic Institutions and Nonprofits only -
pX330_gRNA_IG-DMR-1
Plasmid#159931PurposeSpecific gRNA against mouse IG-DMR cloned in the pX330 backbone (Addgene Number 42230). Deletion of IG-DMR in mouse ESC.DepositorInsertgRNA mouse IG-DMR
UseCRISPR and Mouse TargetingExpressionMammalianPromoterU6, CBhAvailable SinceNov. 17, 2020AvailabilityAcademic Institutions and Nonprofits only -
pX330_gRNA_IG-DMR-2
Plasmid#159932PurposeSpecific gRNA against mouse IG-DMR cloned in the pX330 backbone (Addgene Number 42230). Deletion of IG-DMR in mouse ESC.DepositorInsertgRNA mouse IG-DMR
UseCRISPR and Mouse TargetingExpressionMammalianPromoterU6, CBhAvailable SinceNov. 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
Lenti-XYLT2-sgRNA
Plasmid#154862PurposeLentiviral expression of Cas9 and sgRNA targeting XYLT2DepositorAvailable SinceJuly 27, 2020AvailabilityAcademic Institutions and Nonprofits only -
pMH-HT_SsCHAD-H29A-R32A-R36A
Plasmid#127786PurposeExpresses a SsCHAD mutant protein in E. coli cellsDepositorInsertSsCHAD (SULM_RS11045 Sulfolobus solfataricus)
Tags6xHis tag + TEV cleavage siteExpressionBacterialMutationmutations in His29, Arg32 and Arg36 to AlaAvailable SinceAug. 5, 2019AvailabilityAcademic Institutions and Nonprofits only