We narrowed to 4,460 results for: Abo;
-
Plasmid#212660PurposeExpresses under a CamKII promoter: mito4x-GCaMP6f and a multiple cloning site (MCS) after an IRES sequenceDepositorInsertsUseLentiviralExpressionMammalianMutationD676A, D680AAvailable SinceFeb. 19, 2026AvailabilityAcademic Institutions and Nonprofits only
-
CamKII-mito4x- GCaMP6f-IRES2-rat-Letm1-ΔEFhand
Plasmid#212662PurposeExpresses under a CamKII promoter: mito4x-GCaMP6f and rat-Letm1 with mutations in its EF-handDepositorInsertsUseLentiviralExpressionMammalianMutationD676A, D680AAvailable SinceFeb. 19, 2026AvailabilityAcademic Institutions and Nonprofits only -
Lenti-EF1α-EGFP-WPRE
Plasmid#250407PurposeLentiviral expression of EGFP under EF1α core promoter.DepositorInsertEGFP
UseLentiviralExpressionMammalianPromoterEF1aAvailable SinceFeb. 3, 2026AvailabilityAcademic Institutions and Nonprofits only -
Lenti-EF1α-PPAT-WPRE
Plasmid#250408PurposeLentiviral expression of PPAT under EF1α core promoter.DepositorAvailable SinceFeb. 3, 2026AvailabilityAcademic Institutions and Nonprofits only -
MB 98w3 ttrSR(m13)-Bxb1_P7-bARGSer
Plasmid#232473PurposeOptimized tetrathionate sensor with recombinase switch and acoustic reporter genes (bARGSer)DepositorInsertsttrS
ttrR
PttrB185-269
bARGSer
AxeTxe
Bxb1 integrase
TagsssrA degradation tagExpressionBacterialMutationthe gene Ser39006_001280 was deleted from the clu…PromoterConstitutive (TTGATAGCTAGCTCAGTCCTAGGTATTGTGCTAGC…Available SinceSept. 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
MB 38t3 thsS(t3)R-bARGSer
Plasmid#232468PurposeOptimized thiosulfate sensor with acoustic reporter genes (bARGSer)DepositorInsertsthsS(t3)
thsR
PphsA342
bARGSer
AxeTxe
ExpressionBacterialMutationContains the following mutations K286Q, Q350H, I…PromoterJ23104 (ttgacagctagctcagtcctaggtattgtgctagc), J23…Available SinceSept. 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
PB OROV Gc Spike H6
Plasmid#229662PurposeMake PiggyBac stable cell line expressing Oropouche virus BeAn 19991 Gc spike region (residues 482–894 of M polyprotein) with C-terminal His6 tagDepositorInsertOROV Gc spike
UsePiggybacTags6xHisExpressionMammalianMutationcontains residues 482-894 onlyPromoterTREAvailable SinceAug. 19, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCR8/GW_TOPO_Cdk13_Nterm_FlagHa
Plasmid#127343PurposeN-terminal Flag- HA- tandem epitope tagged mouse Cdk13 transgene (NP_001074527.1 isoform) cloned into Gateway entry vectorDepositorInsertCyclin Dependent Kinase 13 (Cdk13 Mouse)
UseEntry vector with transgene for gateway cloningTagsFlag- HA- Tandem EpitopesMutationBase pairs 1-1554 of transgene are codon optimize…PromoterNoneAvailable SinceDec. 11, 2024AvailabilityAcademic Institutions and Nonprofits only -
PB-Neo-TetO-Cdk13_Untagged
Plasmid#127344PurposeUntagged mouse Cdk13 transgene (NP_001074527.1 isoform) cloned into a dox-inducible piggybac destination vectorDepositorInsertCyclin Dependent Kinase 13 (Cdk13 Mouse)
UsePiggybac transposase vectorTagsNoneExpressionMammalianMutationBase pairs 1-1554 of transgene are codon optimize…PromoterTetO PromoterAvailable SinceDec. 11, 2024AvailabilityAcademic Institutions and Nonprofits only -
PB-Neo-TetO-Cdk13_Nterm_FlagHa
Plasmid#127345PurposeN-terminal Flag- HA- tandem epitope tagged mouse Cdk13 transgene (NP_001074527.1 isoform) cloned into a dox-inducible piggybac destination vectorDepositorInsertCyclin Dependent Kinase 13 (Cdk13 Mouse)
UsePiggybac transposase vectorTagsFlag- HA- Tandem EpitopesExpressionMammalianMutationBase pairs 1-1554 of transgene are codon optimize…PromoterTetO PromoterAvailable SinceDec. 11, 2024AvailabilityAcademic Institutions and Nonprofits only