We narrowed to 9,351 results for: sacs
-
Plasmid#232994PurposeGalactose iduced expression of Gcn4 SATtoG KtoRHAin yeastDepositorInsertGcn4 SATtoG KtoR
Tags3xHA and TEV cleavage siteExpressionYeastMutationS101G, T102G, S104G, T105G, S117G, K118R, T121G, …PromoterGal1Available SinceMarch 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAG415Gal_Gcn4 SATtoG KtoR
Plasmid#232961PurposeGalactose iduced expression of Gcn4 ATtoG KtoR in yeastDepositorInsertGcn4 SATtoG KtoR
TagsTEV cleavage siteExpressionYeastMutationS101G, T102G, S104G, T105G, S117G, K118R, T121G, …PromoterGal1Available SinceMarch 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAG415Gal_Gcn4 SATtoG KtoRGFP
Plasmid#233006PurposeGalactose iduced expression of Gcn4 SATtoG KtoRGFP in yeastDepositorInsertGcn4 SATtoG KtoR
TagsHA-GFP-HA and TEV cleavage siteExpressionYeastMutationS101G, T102G, S104G, T105G, S117G, K118R, T121G, …PromoterGal1Available SinceMarch 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAG415Gal_Gcn4 solvvol W
Plasmid#232977PurposeGalactose iduced expression of Gcn4 solvvol W+ in yeastDepositorInsertGcn4 solvvol W+
Tags3xHA and TEV cleavage siteExpressionYeastMutationS101T, D103E, S104T, D115E, N116Q, S117T, S122T, …PromoterGal1Available SinceMarch 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pDest17_Gcn4 SATtoG KtoR
Plasmid#231861PurposeBacterial expression of N-terminally 6His tagged Gcn4 SATtoG KtoRDepositorInsertGcn4 SATtoG KtoR
Tags6xHis, TEV cleavage siteExpressionBacterialMutationS101G, T102G, S104G, T105G, S117G, K118R, T121G, …PromoterT7Available SinceMarch 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCY5h
Plasmid#160295PurposeYeast CRISPR plasmid targeting the hphMX cassetteDepositorInsertssgRNA expression cassette (with guide targeting hph: GACCTGATGCAGCTCTCGGA)
URA3 selection cassette
sgRNA expression cassette (without guide)
Cas9
UseCRISPRTags8xHis-tag and SV40 NLSAvailable SinceMarch 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCY5n
Plasmid#160296PurposeYeast CRISPR plasmid targeting the natMX cassetteDepositorInsertssgRNA expression cassette (with guide targeting nat: GTACCGCACCAGTGTCCCGG)
URA3 selection cassette
sgRNA expression cassette (without guide)
Cas9
UseCRISPRTags8xHis-tag and SV40 NLSAvailable SinceMarch 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pRS413-TEF1pr-ANP1-FAPoptim
Plasmid#221120PurposeFAP-tagged marker for the cis-Golgi (FAP optimized for yeast expression)DepositorInsertANP1-FAPoptim
ExpressionYeastPromoterTEF1Available SinceMarch 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pRS413-TEF1pr-ERG6-FAPoptim
Plasmid#221121PurposeFAP-tagged marker for lipid droplets (FAP optimized for yeast expression)DepositorInsertERG6-FAPoptim
ExpressionYeastPromoterTEF1Available SinceMarch 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pRS413-TEF1pr-PMA1-FAPoptim
Plasmid#221122PurposeFAP-tagged marker for the plasma membrane (FAP optimized for yeast expression)DepositorInsertPMA1-FAPoptim
ExpressionYeastPromoterTEF1Available SinceMarch 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pRS413-TEF1pr-SEC7-FAPoptim
Plasmid#221124PurposeFAP-tagged marker for the trans-Golgi (FAP optimized for yeast expression)DepositorInsertSEC7-FAPoptim
ExpressionYeastPromoterTEF1Available SinceMarch 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pRS413-TEF1pr-VPH1-FAPoptim
Plasmid#221125PurposeFAP-tagged marker for the vacuolar membrane (FAP optimized for yeast expression)DepositorInsertVPH1-FAPoptim
ExpressionYeastPromoterTEF1Available SinceMarch 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCY5k
Plasmid#160294PurposeYeast CRISPR plasmid targeting the kanMX cassetteDepositorInsertssgRNA expression cassette (with guide targeting kan: TGTTTTGCCGGGGATCGCAG)
URA3 selection cassette
sgRNA expression cassette (without guide)
Cas9
UseCRISPRTags8xHis-tag and SV40 NLSAvailable SinceMarch 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pDest17_Gcn4 ILVtoED solvvol
Plasmid#231858PurposeBacterial expression of N-terminally 6His tagged Gcn4 ILVtoED solvvolDepositorInsertGcn4 ILVtoED solvvol
Tags6xHis, TEV cleavage siteExpressionBacterialMutationS101T, D103E, S104T, D115E, N116Q, S117T, S122T, …PromoterT7Available SinceFeb. 19, 2025AvailabilityAcademic Institutions and Nonprofits only -
pET28a-SdrG-B2-ELP-HIS-ybbR
Plasmid#169134PurposeE. coli expression of SdrG N2, N3 and B2 domains containing ybbR tag and ELP linker. This construct was designed for AFM-SMFS measurements.DepositorInsertStaphylococcus epidermidis fibrinogen-binding protein SD-repeat protein G
Tags3xELP linker, 6x Histag, and ybbr tagExpressionBacterialAvailable SinceOct. 10, 2024AvailabilityAcademic Institutions and Nonprofits only -
pET28a-Fgß-FIVAR-ELP-HIS-ybbR
Plasmid#169136PurposeE. coli expression of FIVAR domain containing Fgß tag, ybbR tag and ELP linker. This construct was designed for AFM-SMFS measurements.DepositorInsertFIVAR (found in various architectures)
Tags3xELP linker, 6x Histag, Fgβ peptide, and ybbr ta…ExpressionBacterialAvailable SinceOct. 10, 2024AvailabilityAcademic Institutions and Nonprofits only -
pET28a-VHH-ddFLN4-HIS-ybbR
Plasmid#169137PurposeE. coli expression of VHH domain containing ybbR tag and ddFLN4 fingerprint domain. This construct was designed for AFM-SMFS measurements.DepositorInsertVHH
Tags6x His tag, ddFLN4 tag, and ybbr tagExpressionBacterialAvailable SinceOct. 10, 2024AvailabilityAcademic Institutions and Nonprofits only -
pET28a-SdrG-B1-ELP-HIS-ybbR
Plasmid#169133PurposeE. coli expression of SdrG N2, N3 and B1 domains containing ybbR tag and ELP linker. This construct was designed for AFM-SMFS measurements.DepositorInsertStaphylococcus epidermidis fibrinogen-binding protein SD-repeat protein G
Tags3xELP linker, 6x Histag, and ybbr tagExpressionBacterialAvailable SinceOct. 10, 2024AvailabilityAcademic Institutions and Nonprofits only -
pGEMHE:hTRAAK(Q258K)
Plasmid#224763PurposeIn vitro transcription for Oocyte expression of hTRAAK(Q258K)DepositorInsertPotassium channel subfamily member 4 (KCNK4 Human)
UseIn vitro transcription for oocyte expressionMutationQ258KPromoterT7Available SinceSept. 18, 2024AvailabilityAcademic Institutions and Nonprofits only -
pGEMHE:mTREK-1
Plasmid#224743PurposeIn vitro transcription for Oocyte expression of mTREK-1DepositorInsertPotassium channel subfamily K member 2 (Kcnk2 Mouse)
UseIn vitro transcription for oocyte expressionPromoterT7Available SinceSept. 18, 2024AvailabilityAcademic Institutions and Nonprofits only