We narrowed to 6,887 results for: crispr cas9 plasmids

#87388

All-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS607c sequence CTATTTTTGCTTTCTGCACA in yeast chromosome 6.

Aindrila Mukhopadhyay

Reider Apel et al Nucleic Acids Res. 2017 Jan 9;45(1):496-

April 5, 2017

Academic Institutions and Nonprofits only

#87389

All-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting SAP155b sequence GGTTTTCATACTGGGGCCGC in yeast chromosome 6

Aindrila Mukhopadhyay

Reider Apel et al Nucleic Acids Res. 2017 Jan 9;45(1):496-

April 5, 2017

Academic Institutions and Nonprofits only

#87393

All-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS805a sequence TTATTTGAATGATATTTAGT in yeast chromosome 8.

Aindrila Mukhopadhyay

Reider Apel et al Nucleic Acids Res. 2017 Jan 9;45(1):496-

April 5, 2017

Academic Institutions and Nonprofits only

#87398

All-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS1206a sequence CGAACATTTTTCCATGCGCT in yeast chromosome 12.

Aindrila Mukhopadhyay

Reider Apel et al Nucleic Acids Res. 2017 Jan 9;45(1):496-

April 5, 2017

Academic Institutions and Nonprofits only

#87400

All-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS1414a sequence GCGCCACAGTTTCAAGGGTC in yeast chromosome 14.

Aindrila Mukhopadhyay

Reider Apel et al Nucleic Acids Res. 2017 Jan 9;45(1):496-

April 5, 2017

Academic Institutions and Nonprofits only

#87385

All-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting RDS1a sequence ATTCAATACGAAATGTGTGC in yeast chromosome 3

Aindrila Mukhopadhyay

Reider Apel et al Nucleic Acids Res. 2017 Jan 9;45(1):496-

April 5, 2017

Academic Institutions and Nonprofits only

#206936

Expression of spCas9 endonuclease and gRNA in an AAV vector allowing packaging of viral genome smaller than 5 kb.

Markus Grompe

Sept. 13, 2023

Academic Institutions and Nonprofits only

#167877

PiggyBac compatible plasmid expressing dCas9-KRAB

Alejandro Chavez, Nan Cher Yeo

Nghi Dang et al Synthetic Biology, Volume 6, Issue 1, 20

Feb. 9, 2022

Academic Institutions and Nonprofits only

#203223

Mammalian expression of vCas9

Vikash Chauhan, Robert Langer, Phil Sharp

Chauhan et al Proc Natl Acad Sci U S A. 2023 Mar 14;12

Aug. 25, 2023

Academic Institutions and Nonprofits only

#138709

Plasmid constitutively expressing the Cas9 nuclease and the non-coding tracrRNA from S. pyogenes

Víctor de Lorenzo

Velazquez et al ACS Synth Biol. 2019 Sep 20;8(9):2186-21

Sept. 17, 2020

Academic Institutions and Nonprofits only