We narrowed to 81,199 results for: myc
-
Plasmid#176811PurposeEncodes codon optimized putative thermophilic PET hydrolase enzyme for bacterial expressionDepositorInsert605
Tags6xHisExpressionBacterialPromoterT7Available SinceNov. 28, 2022AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-mCherry-mCherry-FLARE-CKAR
Plasmid#123345PurposeRed-fluorescent homoFRET/anisotropy-based biosensor for monitoring Protein Kinase C activity.DepositorInsertmCherry-mCherry-FLARE-CKAR
Tags6xHIS, T7 tag (gene 10 leader), Xpress (TM) tag, …ExpressionMammalianPromoterCMVAvailable SinceJuly 28, 2020AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-Cerulean3-Cerulean3-FLARE-AKAR
Plasmid#123335PurposeCyan-fluorescent homoFRET/anisotropy-based biosensor for monitoring Protein Kinase A activity.DepositorInsertCerulean3-Cerulean3-FLARE-AKAR
Tags6xHIS, Cerulean3, T7 tag (gene 10 leader), and Xp…ExpressionMammalianPromoterCMVAvailable SinceJuly 28, 2020AvailabilityAcademic Institutions and Nonprofits only -
GS2.1/EC
Plasmid#132568PurposesgRNA targeting A. thaliana pds3, regulated by A. thaliana U6 polIII promoter. Cas9 with a C-terminal mApple fusion, egg cell-specific expression. Hygromycin selectable marker (hpt).DepositorInsertegg cell promoter, Cas9-mApple, pds3 sgRNA
UseCRISPR and Synthetic BiologyExpressionPlantPromoterA. thaliana egg cell promoterAvailable SinceDec. 10, 2019AvailabilityAcademic Institutions and Nonprofits only -
pNK5867
Plasmid#219751PurposepGAP-like vector encoding hispidin-synthase from Mycena citricolor under control of GAP promoter, for yeast expressionDepositorInsertpGAP - mcitHispS - tAOX
ExpressionYeastAvailable SinceAug. 1, 2024AvailabilityAcademic Institutions and Nonprofits only -
pEX-PK-hLC3
Plasmid#61458PurposeExpress pHluorin-mKate2-hLC3 (PK-hLC3) in mammalian cells for monitoring autophagyDepositorAvailable SinceFeb. 7, 2015AvailabilityAcademic Institutions and Nonprofits only -
pHSN6A01
Plasmid#50586PurposeCRISPR/Cas based plant genome editing and gene regulation; expresses dCas9-VP64, gRNA scaffold for insertion of target sequence (AtU6-26 promoter), Hyg resistanceDepositorInsertsdCas9-VP64
gRNA scaffold
UseCRISPR; Plant expressionTags3xFLAG, HA, and NLSMutationdCas9 = defective in DNA cleavage; 4×minimal VP16…Promoter2×35Sp and AtU6-26pAvailable SinceDec. 11, 2014AvailabilityAcademic Institutions and Nonprofits only -
pEpicVector3mC_Puro-T2A-mCherry-HA-FLAG-AU1
Plasmid#162118PurposemCherry linked to 3 tags on the C-terminus as barcodes. Puromycin resistant.DepositorInsertPuromycin resistant; mCherry linked to HA-FLAG-AU1
UseLentiviralTagsHA-FLAG-AU1MutationWTPromoterEF1AAvailable SinceSept. 30, 2022AvailabilityAcademic Institutions and Nonprofits only -
pHSN6I01
Plasmid#50587PurposeCRISPR/Cas based plant genome editing and gene regulation; expresses dCas9-KRAB, gRNA scaffold for insertion of target sequence (AtU6-26 promoter), Hyg resistanceDepositorInsertsdCas9-KRAB
gRNA scaffold
UseCRISPR; Plant expressionTags3xFLAG, HA, and NLSMutationdCas9 that is defective in DNA cleavage; the maiz…Promoter2×35Sp and AtU6-26pAvailable SinceDec. 11, 2014AvailabilityAcademic Institutions and Nonprofits only -
pHAGE2-EF1a-E1MLS-2xFLAG-LigD-IRES-tdTomato
Plasmid#234951PurposeHuman codon optimized LigD (Mycobacterium) with N-terminal E1 MLS expressing plasmidDepositorInsertHuman codon optimized LigD with N-terminal mitochondrial localization signal of pyruvate dehydrogenase E1 subunit
UseLentiviralTagsFLAGExpressionMammalianPromoterEF1AAvailable SinceApril 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
hZMPSTE24-3FLAG_pQCXIP
Plasmid#89759PurposeHuman ZMPSTE24 mammalian expression vector. Retroviral bicistronic puromycin vector.DepositorInsertHomo sapiens zinc metallopeptidase STE24 (ZMPSTE24) (ZMPSTE24 Human)
UseRetroviral; Bicistronic expression: puromycin re…Tags9bp spacer (NotI site) - 3xFLAG epitopes - Stop c…ExpressionMammalianMutationY253H in ZMPSTE24 (see depositor comments below)PromoterCMVAvailable SinceJune 8, 2017AvailabilityAcademic Institutions and Nonprofits only -
pLV-dCas9-KRAB-PGK-HygR
Plasmid#83890PurposeLentiviral Sp dCas9-KRAB fusion with Hygromycin B resistance cassette.DepositorInsertshumanized dead Cas9 KRAB
aminoglycoside phosphotransferase from E. coli
UseCRISPR and LentiviralTagsFlagMutationD10A and H840APromoterHuman Ubiquitin C Promoter and mouse phosphoglyce…Available SinceApril 6, 2017AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-Lyso-AktAR2
Plasmid#64933PurposeLysosome-targeted FRET biosensor for monitoring Akt activity; targeted to cytosolic face of lysosomal membrane.DepositorInsertLAMP1-AktAR2 (LAMP1 Synthetic, Budding Yeast, Human)
TagsCerulean3, Full-length LAMP1, and cpVenus[E172]ExpressionMammalianPromoterCMVAvailable SinceJuly 8, 2015AvailabilityAcademic Institutions and Nonprofits only -
pSicoR-Ef1a-mCh-Puro
Plasmid#31845PurposeCre-regulated lentiviral shRNA vector. Cre addition causes both mCherry and shRNA to be recombined out of the construct, turning OFF shRNA expression. Includes puromycin selection.DepositorTypeEmpty backboneUseCre/Lox, Lentiviral, and RNAiExpressionMammalianPromoterU6 for shRNA; Ef1alpha for mCherry-puromycinAvailable SinceJan. 3, 2012AvailabilityAcademic Institutions and Nonprofits only -
pA-CBh.TP-CNOT8-V5H6.MCh.Puro
Plasmid#209947PurposeIn mammalian cells expresses TP fused to a CNOT8 with a V5H6 tag. Also expresses an mCherry fluorescent protein and puromycin resistance marker.DepositorInsertsCCR4-NOT transcription complex subunit 8 (CNOT8 Human)
mCherry fluorescent protein fused to puromycin resistance marker
TagsTP (MS2 coat protein) and V5 epitope with H6 tagExpressionMammalianPromoterCBh and CMVAvailable SinceJuly 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
pSLQ5465_pHR_hU6-crScaffold_EF1a-PuroR-T2A-BFP
Plasmid#155307PurposeRfx Cas13d guide cloning lentiviral vector with constitutively expressed puromycin resistance 2A-tagged with tagBFPDepositorInsertRfx Cas13d CRISPR RNA puromycin resistance 2A-tagged BFP
UseLentiviralExpressionMammalianPromoterhU6, EF1aAvailable SinceJuly 21, 2020AvailabilityAcademic Institutions and Nonprofits only -
Dronpa-FHA1
Plasmid#87711PurposeEncodes N-terminal (PAABD) fragment of bimolecular super-resolution PKA activity reporter (bimFLINC-AKAR).DepositorInsertDronpa-FHA1
Tags6xHis, T7 tag (gene 10 leader), and Xpress (TM) t…ExpressionMammalianPromoterCMVAvailable SinceFeb. 22, 2018AvailabilityAcademic Institutions and Nonprofits only -
pDIV313
Plasmid#204956PurposeAMA1 plasmid with Aspergillus optimized Mad7, hph (hygromycin) resistance marker and sgRNA targeting albA locus in A. nigerDepositorInsertsMad7
hph (hygromycin resistance marker)
sgRNA (CAGCAATGCTTCCATGCAATT) targeting albA locus in A. niger flanked by a tRNA-Gly repeat
UseCRISPR; Fungal expressionTagsSV40 NLSExpressionBacterialPromoterAspergillus fumigatus U3 promoter, Aspergillus ni…Available SinceNov. 21, 2023AvailabilityAcademic Institutions and Nonprofits only -
pSEVA228-pro4IUPi
Plasmid#122018PurposeExpresses IUP pathway genes (ChK, IPK, idi) under constitutive promoter. Kan. resist.DepositorInsertsExpressionBacterialMutationCodon optimized for E. coliPromoterpro4Available SinceOct. 16, 2020AvailabilityAcademic Institutions and Nonprofits only -
p3e UbB polyA
Plasmid#188702PurposeGateway 3' element encoding the ubiquitin B polyadenylation sequenceDepositorAvailable SinceAug. 29, 2022AvailabilityAcademic Institutions and Nonprofits only