We narrowed to 168,035 results for: addgene
-
-
-
pMP650
Plasmid#135000PurposeVP64-m6A Reader. Activates transcription near Gm6ATC sites. pUBC-DpnI(aa146-254)-VP64-V5 pGK-ZeoRDepositorInsertpUBC-DpnI(aa146-254)-VP64-V5 pGK-ZeoR
UseLentiviral and Synthetic BiologyTagsDpnI(aa146-254), V5 tag, and VP-64ExpressionMammalianMutationDpnI truncated to aa146-254Available SinceMarch 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
pRRG43-sFRP1
Plasmid#99071PurposedsRNA and riboprobe synthesis for Schmidtea mediterranea sFRP1 (secreted frizzled related protein 1)DepositorInsertsFRP1 (secreted frizzled related protein 1) in situ probe
UseT/a cloning vector for dsrna generation and the g…Available SinceSept. 18, 2017AvailabilityAcademic Institutions and Nonprofits only -
TET-pLKO-neo CXCR4-sh3
Plasmid#163743PurposeLentivirus for inducible knockdown of CXCR4 (human)DepositorAvailable SinceJan. 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
pFGC5941-PacI-ath-STTM829.2
Plasmid#84158Purposetarget miRNA829.2 for destruction in Arabidopsis thalianaDepositorInsertSTTM829.2
ExpressionPlantPromoter2x35SAvailable SinceDec. 2, 2016AvailabilityAcademic Institutions and Nonprofits only -
TET-pLKO-neo CXCR4-sh1
Plasmid#163741PurposeLentivirus for inducible knockdown of CXCR4 (human)DepositorAvailable SinceApril 21, 2021AvailabilityAcademic Institutions and Nonprofits only -
TET-pLKO-neo CXCR4-sh2
Plasmid#163742PurposeLentivirus for inducible knockdown of CXCR4 (human)DepositorAvailable SinceJan. 25, 2021AvailabilityAcademic Institutions and Nonprofits only -
pT7-AsCas12a_crRNA-site3 (RTW549)
Plasmid#160138PurposeT7 promoter expression plasmid for in vitro transcription of AsCas12a crRNA with spacer #3DepositorInsertAsCas12a crRNA with spacer #3 (spacer=CTGATGGTCCATGTCTGTTACTC)
UseIn vitro transcription of sgrna from t7 promoterPromoterT7Available SinceFeb. 8, 2021AvailabilityAcademic Institutions and Nonprofits only -
