We narrowed to 8,732 results for: sgRNA
-
Plasmid#124042PurposeEncodes pEF1a driving expression of TET3G P2A iRFP713, pEF1a expressing spdCas9 fused to tagBFP P2A tagBFP, and an sgRNA targeting pTRE expressing mAzamiGreen in a PiggyBac destination vectorDepositorInsertPB_pEF1a-tet3G-P2A-iRFP713_pEF1a-spdCAS9::tagBFP-P2A-tagBFP-SV40PA_mu6-sgTRE_pTRE-NLS::mAzamiGreen-rgPA
ExpressionMammalianAvailable SinceDec. 13, 2019AvailabilityAcademic Institutions and Nonprofits only -
pJMP1102
Plasmid#119246Purposeknockdown phzA1 in P. aeruginosaDepositorInsertsgRNA phzA1 (P. aeruginosa)
ExpressionBacterialMutationD10A and H840AAvailable SinceFeb. 4, 2019AvailabilityAcademic Institutions and Nonprofits only -
pJMP1103
Plasmid#119247Purposeknockdown phzM in P. aeruginosaDepositorInsertsgRNA phzM (P. aeruginosa)
ExpressionBacterialMutationD10A and H840AAvailable SinceFeb. 4, 2019AvailabilityAcademic Institutions and Nonprofits only -
pJMP1055
Plasmid#119242Purposeconstruction intermediateDepositorInsertsgRNA NT1/RR1 (rfp)
ExpressionBacterialAvailable SinceDec. 27, 2018AvailabilityAcademic Institutions and Nonprofits only -
LentiCRISPR v2-sgAMPK alpha1 clone2
Plasmid#162120PurposeLentiviral sgRNA plasmid targeting human AMPK alpha1DepositorInsertsgAMPK alpha1 (PRKAA1 Human)
UseLentiviralAvailable SinceJan. 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
pGMC00013
Plasmid#172525PurposesgRNA against mouse Mr1DepositorAvailable SinceAug. 11, 2021AvailabilityAcademic Institutions and Nonprofits only -
pGMC00014
Plasmid#172526Purposenon targeting sgRNADepositorInsertNon-targeting guide
UseLentiviralExpressionMammalianAvailable SinceAug. 11, 2021AvailabilityAcademic Institutions and Nonprofits only -
Direct-seq_lentiGuide-Puro-Tail-8A8G
Plasmid#157981PurposeExpresses programmed gRNA scaffold from U6 promoter. Programmed gRNA scaffold for streamlined scRNA-seq in CRISPR screen (Direct-seq). 3rd generation lentiviral backbone.DepositorInsertS. pyogenes sgRNA cassette (Tail-8A8G)
UseCRISPR and LentiviralExpressionMammalianPromoterhU6Available SinceAug. 24, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLenti-Puro-SIK2
Plasmid#138696PurposeExpresses a human SIK2-targeting sgRNA and Cas9DepositorAvailable SinceFeb. 26, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLenti-Puro-SIK3
Plasmid#138697PurposeExpresses a human SIK3-targeting sgRNA and Cas9DepositorAvailable SinceFeb. 26, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLenti-Hygro-sgTom
Plasmid#138698PurposeExpresses a tomato-targeting sgRNA and Cas9DepositorInsertsgTomato
UseLentiviralPromoterhU6Available SinceFeb. 26, 2020AvailabilityAcademic Institutions and Nonprofits only -
pJMP1239
Plasmid#119263Purposeknockdown folA in P. aeruginosaDepositorInsertsgRNA folA (P. aeruginosa)
ExpressionBacterialMutationD10A and H840AAvailable SinceJan. 7, 2019AvailabilityAcademic Institutions and Nonprofits only -
p2T CAG dCas9-10XGcn4-P2A-mCherry BlastR
Plasmid#186745PurposedCas9-10XGcn4-P2A-mCherry expression constructDepositorInsertCas9-10XGcn4-P2A-mCherry
UseCRISPRExpressionMammalianAvailable SinceApril 24, 2023AvailabilityAcademic Institutions and Nonprofits only -
-
pGL3-U6-pegRNA_FANCF-EGFP
Plasmid#159785PurposeS. pyogenes pegRNA for C to A mutation at the FANCF site of human cells using prime editingDepositorInsertspacer of pegRNA targeting FANCF gene (FANCF Human)
ExpressionMammalianAvailable SinceOct. 20, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAAVsc.U6-sgFah.CMV/CB-EGFP
Plasmid#121508PurposeExpresses sgRNA targeting mouse Fah intron 7 (sgFah).DepositorInsertsgFah
UseAAVExpressionMammalianPromoterU6Available SinceFeb. 5, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMV-dSa VP64 Actc1
Plasmid#99691PurposeExpresses dSa Cas9 fused to gold standard VP64 activator domain and Sa sgRNA for Actc1 promoter, vector allows for activation of mouse Actc1, can be packaged and delivered as AAVDepositorArticleInsertdCas9 and gRNA targeting Actc1 (gRNA sequence: GCCATTCTTGGAGCCAAGGG) (Actc1 Mouse, Synthetic)
UseAAV and CRISPRTagsVP64Mutationdead Cas9Available SinceDec. 21, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMV-dSa VP64 Neurog2
Plasmid#99695PurposeExpresses dSa Cas9 fused to gold standard VP64 activator domain and Sa sgRNA for Neurog2 promoter, vector allows for activation of mouse Neurog2, can be packaged and delivered as AAVDepositorArticleInsertdCas9 and gRNA targeting Neurog2 (gRNA: GGTATATAAGGGGTTTTAAG) (Neurog2 Mouse, Synthetic)
UseAAV and CRISPRTagsVP64Mutationdead Cas9Available SinceSept. 22, 2018AvailabilityAcademic Institutions and Nonprofits only -
pJMP1344
Plasmid#119273Purposeknockdown folA in E. aerogenesDepositorInsertsgRNA folA (E. aerogenes)
ExpressionBacterialMutationD10A and H840AAvailable SinceJan. 10, 2019AvailabilityAcademic Institutions and Nonprofits only -
pJMP1106
Plasmid#119249Purposeconstruction intermediateDepositorInsertsgRNA NT1/RR1 (rfp)
ExpressionBacterialMutationD10A and H840AAvailable SinceJan. 3, 2019AvailabilityAcademic Institutions and Nonprofits only