We narrowed to 27,503 results for: cat
-
Plasmid#235457PurposeOR/NAND gate receiver with bs for sgRNA2 and sgRNA3DepositorInsertOR gate
UseSynthetic BiologyAvailable SinceMay 19, 2025AvailabilityAcademic Institutions and Nonprofits only -
pYO361
Plasmid#235748PurposeProtein expression of ScVPS34 HELCATDepositorInsertVPS34 HELCAT
ExpressionYeastMutationaa 268-875Available SinceMay 14, 2025AvailabilityAcademic Institutions and Nonprofits only -
BtARR2 short
Plasmid#236267PurposeBacterial expression of bovine arrestin-2 short isoformDepositorAvailable SinceMay 12, 2025AvailabilityAcademic Institutions and Nonprofits only -
pHK346
Plasmid#235477PurposeInducible gene VIII by Pbad promoterDepositorInsertphage M13 geneVIII
ExpressionBacterialAvailable SinceMay 9, 2025AvailabilityAcademic Institutions and Nonprofits only -
pHK336
Plasmid#235476PurposeInducible gene VIII by Plux promoterDepositorInsertphage M13 geneVIII
ExpressionBacterialAvailable SinceMay 9, 2025AvailabilityAcademic Institutions and Nonprofits only -
pHK-cinI
Plasmid#235486PurposeInducible gene cinI for OC14-HSL production by Ptac promoterDepositorInsertcinI
ExpressionBacterialAvailable SinceMay 9, 2025AvailabilityAcademic Institutions and Nonprofits only -
ADEPT-pTarget-tetR
Plasmid#238043PurposeModified ADEPT-pCas9 with sfGFP under TtrB promoter for tetrathionate (TTR) sensing.DepositorInsertsfGFP
UseSynthetic BiologyPromoterttrBAvailable SinceMay 6, 2025AvailabilityAcademic Institutions and Nonprofits only -
REV7 C-terminal sgRNA
Plasmid#207095PurposepX330 based plasmid for expression of Cas9 and the GCTCATAAAGGCAGCTGAGG sgRNA to target the REV7 locus.DepositorInsertGCTCATAAAGGCAGCTGAGG
ExpressionMammalianPromoterCMV and U6Available SinceMay 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
pHK001.3QS
Plasmid#235485Purposeinducible NOT gate receiver with bs for sgRNA3DepositorInsertNOT gate
UseSynthetic BiologyAvailable SinceApril 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
pHK001.23
Plasmid#235484Purposedual NOT gate receiver with bs for sgRNA2 and sgRNA3DepositorInsertNOT gate
UseSynthetic BiologyAvailable SinceApril 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
pHK001.1
Plasmid#235449PurposeNOT gate receiver with binding site (bs) for sgRNA1DepositorInsertNOT gate
UseSynthetic BiologyAvailable SinceApril 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
pHK001.2
Plasmid#235450PurposeNOT gate receiver with bs for sgRNA2DepositorInsertNOT gate
UseSynthetic BiologyAvailable SinceApril 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
pHK001.3
Plasmid#235451PurposeNOT gate receiver with bs for sgRNA3DepositorInsertNOT gate
UseSynthetic BiologyAvailable SinceApril 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
pHK001.4
Plasmid#235452PurposeNOT gate receiver with bs for sgRNA4DepositorInsertNOT gate
UseSynthetic BiologyAvailable SinceApril 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
pHK001.5
Plasmid#235453PurposeNOT gate receiver with bs for sgRNA5DepositorInsertNOT gate
UseSynthetic BiologyAvailable SinceApril 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
pHK001.6
Plasmid#235454PurposeNOT gate receiver with bs for sgRNA6DepositorInsertNOT gate
UseSynthetic BiologyAvailable SinceApril 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-L7-6-DD-T6B-WT-YFP
Plasmid#235145PurposeExpresses the inducible T6B peptide fused with DHFR and YFP under the Purkinje cell-specific L7-6 promoterDepositorInsertDHFR-fused T6B peptide
UseAAVPromoterL7-6Available SinceApril 23, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-L7-6-FLAG-HA-T6B-WT-YFP
Plasmid#235141PurposeExpresses the T6B peptide fused with YFP under the Purkinje cell-specific L7-6 promoterDepositorInsertT6B peptide
UseAAVTagsFLAG/HAPromoterL7-6Available SinceApril 23, 2025AvailabilityAcademic Institutions and Nonprofits only -
T7-RBS-6xHis-SUMO-SynCas.v10 bacteria
Plasmid#208594PurposeProduction and purification of catalytically active SynCas.v10DepositorInsertSynCas.v10
ExpressionBacterialPromoterT7Available SinceApril 7, 2025AvailabilityAcademic Institutions and Nonprofits only -
T7-RBS-6xHis-SUMO-dSynCas.v10 bacteria
Plasmid#208595PurposeProduction and purification of catalytically inactive SynCas.v10DepositorInsertdSynCas.v10
ExpressionBacterialPromoterT7Available SinceApril 7, 2025AvailabilityAcademic Institutions and Nonprofits only