We narrowed to 9,835 results for: CAG
-
Plasmid#227446Purpose6-mer gRNA array targeting Sp dCas9/Cas9 to the Prdm8-Fgf5 locusDepositorInsertCARGO to 20kb Upstream Prdm8
UseCRISPRAvailable sinceMay 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLenti-multi-CRISPR-sgRipk1_#1-puro
Plasmid#231984PurposeKnockout mouse Ripk1DepositorInsertsgRNA with Cas9 with puromycin resistance (Ripk1 Mouse)
UseCRISPR and LentiviralAvailable sinceFeb. 19, 2025AvailabilityAcademic Institutions and Nonprofits only -
LentiU6-hIL1RN gRNA_1-MS2-Puro
Plasmid#192677PurposeLentiviral expression of sgRNA targeting hIL1RN promoter to activate human IL1RN transcriptionDepositorInsertHuman IL1RN activating gRNA #1 (IL1RN Human)
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available sinceDec. 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
mmu-miR-30a natural design (NAT)
Plasmid#107791PurposemiR-30a RNAi ExpressionDepositorInsertwhole pre-mmu-miR-30a gene (Mir30a Mouse)
UseRNAiTagsEmGFPExpressionMammalianPromoterCMVAvailable sinceOct. 31, 2018AvailabilityAcademic Institutions and Nonprofits only -
NSL1 C6.4 gRNA
Plasmid#90805Purpose3rd generation lentiviral gRNA plasmid targeting human NSL1DepositorInsertNSL1 (Guide Designation C6.4)
UseCRISPR and LentiviralPromoterU6Available sinceJuly 24, 2017AvailabilityAcademic Institutions and Nonprofits only -
MTCH2 D4.3 gRNA
Plasmid#90775Purpose3rd generation lentiviral gRNA plasmid targeting human MTCH2DepositorInsertMTCH2 (Guide Designation D4.3)
UseCRISPR and LentiviralPromoterU6Available sinceJuly 24, 2017AvailabilityAcademic Institutions and Nonprofits only -
DLGAP5 D1.4 gRNA
Plasmid#90654Purpose3rd generation lentiviral gRNA plasmid targeting human DLGAP5DepositorInsertDLGAP5 (Guide Designation D1.4)
UseCRISPR and LentiviralPromoterU6Available sinceJuly 20, 2017AvailabilityAcademic Institutions and Nonprofits only -
CHEK1 C2.2 gRNA
Plasmid#90627Purpose3rd generation lentiviral gRNA plasmid targeting human CHEK1DepositorInsertCHEK1 (Guide Designation C2.2)
UseCRISPR and LentiviralPromoterU6Available sinceJuly 20, 2017AvailabilityAcademic Institutions and Nonprofits only -
ELAVL1 E6.3 gRNA
Plasmid#90679Purpose3rd generation lentiviral gRNA plasmid targeting human ELAVL1DepositorInsertELAVL1 (Guide Designation E6.3)
UseCRISPR and LentiviralPromoterU6Available sinceJuly 19, 2017AvailabilityAcademic Institutions and Nonprofits only -
ZWILCH H11.1 gRNA
Plasmid#90945Purpose3rd generation lentiviral gRNA plasmid targeting human ZWILCHDepositorInsertZWILCH (Guide Designation H11.1)
UseCRISPR and LentiviralPromoterU6Available sinceJuly 17, 2017AvailabilityAcademic Institutions and Nonprofits only -
BUB1 A5.1 gRNA
Plasmid#90552Purpose3rd generation lentiviral gRNA plasmid targeting human BUB1DepositorInsertBUB1 (Guide Designation A5.1)
UseCRISPR and LentiviralPromoterU6Available sinceJuly 17, 2017AvailabilityAcademic Institutions and Nonprofits only -
AOI-WT-Cas9-sg-mouse Gfi1-exon4(F1)-GFP
Plasmid#91883PurposeExpresses 3xFLAG-Cas9 and a gRNA targeting mouse Gfi1DepositorPublicationAvailable sinceJune 26, 2017AvailabilityAcademic Institutions and Nonprofits only -
AURKC gRNA (BRDN0001146500)
Plasmid#78054Purpose3rd generation lentiviral gRNA plasmid targeting human AURKCDepositorAvailable sinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
CSNK2B gRNA (BRDN0001147766)
Plasmid#77400Purpose3rd generation lentiviral gRNA plasmid targeting human CSNK2BDepositorAvailable sinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
TAOK2 gRNA (BRDN0001148565)
Plasmid#77249Purpose3rd generation lentiviral gRNA plasmid targeting human TAOK2DepositorAvailable sinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
PIK3CG gRNA (BRDN0001147429)
Plasmid#76333Purpose3rd generation lentiviral gRNA plasmid targeting human PIK3CGDepositorAvailable sinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
LMTK2 gRNA (BRDN0001148094)
Plasmid#76175Purpose3rd generation lentiviral gRNA plasmid targeting human LMTK2DepositorAvailable sinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
NTRK1 gRNA (BRDN0001148112)
Plasmid#75965Purpose3rd generation lentiviral gRNA plasmid targeting human NTRK1DepositorAvailable sinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
BUB1B gRNA (BRDN0001148077)
Plasmid#75918Purpose3rd generation lentiviral gRNA plasmid targeting human BUB1BDepositorAvailable sinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
pFP59
Plasmid#247215PurposeExpresses superfolder GFP (sfGFP) and a Pepper RNA aptamer (tDF30ppr) from an E. coli sigma70 promoter. Suitable for cell-free expression.DepositorInsertssuperfolder GFP
Dimeric Pepper RNA aptamer (with tRNA and F30 scaffolds)
UseSynthetic Biology; E. coli-based cell-free expres…TagsStreptavidin tagExpressionBacterialMutationTwo mutations were made to the second Pepper unit…PromoterPj23100 (ttgacggctagctcagtcctaggtacagtgctagc)Available sinceMay 29, 2026AvailabilityAcademic Institutions and Nonprofits only