We narrowed to 12,134 results for: cel.2
-
Plasmid#114427PurposeTarget a Cre-dependent GFP and a tTA2 expression cassette into the mouse TIGRE locusDepositorInsertGFP, tTA2
UseCre/Lox and Mouse TargetingExpressionMammalianPromoterPGK, CAGAvailable SinceJan. 7, 2019AvailabilityAcademic Institutions and Nonprofits only -
Ai133 (TITL-ssAPEX2tm) targeting vector
Plasmid#114432PurposeTarget a Cre-dependent electron microscopy tag ssAPEX2tm cassette into the mouse TIGRE locusDepositorInsertssAPEX2tm
UseCre/Lox and Mouse TargetingPromoterTREtightAvailable SinceJan. 7, 2019AvailabilityAcademic Institutions and Nonprofits only -
Ai161 (TIT2L-GFP-ICR-tTA2) targeting vector
Plasmid#114429PurposeTarget a Cre-dependent GFP cassette and Dre-dependent tTA2 cassette to the mouse TIGRE locusDepositorInsertGFP
UseCre/Lox and Mouse TargetingPromoterTRE2, CAGAvailable SinceJan. 7, 2019AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.2 TDP-43 YFP
Plasmid#84911Purposeexpression of TDP-43 YFP in mammalian cellsDepositorAvailable SinceNov. 23, 2016AvailabilityAcademic Institutions and Nonprofits only -
pCMV-TNT-CFP-STIM1-C227W
Plasmid#68403PurposeExpresses a STIM1 gain-of-function mutant in mammalian cellsDepositorInsertCFP-STIM1 (STIM1 Human)
TagsCyan Fluorescent Protein (CFP)ExpressionMammalianMutationChanged Cysteine 227 to Tryptophan; CFP was inser…PromoterCMVAvailable SinceNov. 13, 2015AvailabilityAcademic Institutions and Nonprofits only -
Ai139 (TIT2L-GFP-ICL-TPT) targeting vector
Plasmid#114426PurposeTarget a Cre-dependent GFP and a tdTomato-P2A-tTA2 expression cassette into the mouse TIGRE locusDepositorInsertGFP, tdTomato, tTA2,
UseCre/Lox and Mouse TargetingPromoterTRE2, CAGAvailable SinceJan. 7, 2019AvailabilityAcademic Institutions and Nonprofits only -
Ai163 (TIT2L-GC6s-ICL-TPT) targeting vector
Plasmid#114430PurposeTarget a Cre-dependent GCaMP6s cassette and a tdTomato-P2A-tTA2 cassette to the mouse TIGRE locusDepositorInsertGCaMP6s, tdTomato, tTA2
UseCre/Lox and Mouse TargetingPromoterTRE2, CAGAvailable SinceJan. 7, 2019AvailabilityAcademic Institutions and Nonprofits only -
Ai167 (TIT2L-ChrimsonR-tdT-ICL-tTA2) targeting vector
Plasmid#114431PurposeTarget a Cre-dependent ChrimsonR-tdTomato cassette and a tTA2 cassette into the mouse TIGRE locusDepositorInsertChrimsonR-tdTomato, tTA2
UseCre/Lox and Mouse TargetingPromoterTRE2, CAGAvailable SinceJan. 7, 2019AvailabilityAcademic Institutions and Nonprofits only -
Ai170 (TIT2L-ASAP2s-Kv-ICL-tTA2) targeting vector
Plasmid#114435PurposeTarget a Cre-dependent voltage sensor ASAP2s cassette into the mouse TIGRE locusDepositorInsertASAP2s-Kv, tTA2
UseCre/Lox and Mouse TargetingTagsKv2.1 tagPromoterTRE2, CAGAvailable SinceJan. 7, 2019AvailabilityAcademic Institutions and Nonprofits only -
CLYBL-(Ef1a-SBP-LNGFR-T2A-mApple)-(CAG-rtTA)-(TRE-hNIL))
Plasmid#105842PurposeDonor construct for introduction of hNIL factors and SBP-LNGFR for streptavidin bead enrichmentDepositorInsertsUseCRISPR and TALENPromoterCAG, EF-1alpha, and TRE3GAvailable SinceApril 13, 2018AvailabilityAcademic Institutions and Nonprofits only -
pCMV(MinDis).iGluSnFR
Plasmid#41732PurposeSingle-wavelength extracellular glutamate sensor constructed from E. coli Gltl and cpGFP. Membrane-displayed. ** A newer version of this sensor is available. Please see iGluSnFR3 plasmids at https://www.addgene.org/browse/article/28220233/ **DepositorInsertGltI based Glutamate Biosensor
UseGlutamate biosensorTagsMyc, PDGFR transmembrane helix (aa 513-561), and …ExpressionMammalianMutationcpGFP146 variant from EcMBP165-cpGFP.PPYF.pRSET i…PromoterCMVAvailable SinceJan. 3, 2013AvailabilityAcademic Institutions and Nonprofits only -
pCDNA5_miniTurbo-C12orf49
Plasmid#155111Purposetransfection plasmid for the exogneous expression of N-terminal miniTurbo-tagged C12orf49 for generation of FlpIn cell lines for BioIDDepositorInsertC12orf49 (SPRING1 Human)
TagsminiTurboExpressionMammalianPromoterCMV/TO inducible promoterAvailable SinceAug. 7, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCDNA5_C12orf49-miniTurbo
Plasmid#155112Purposetransfection plasmid for the exogneous expression of C-terminal miniTurbo-tagged C12orf49 for generation of FlpIn cell lines for BioIDDepositorInsertC12orf49 (SPRING1 Human)
Tags3x Flag and miniTurboExpressionMammalianPromoterCMV/TO inducible promoterAvailable SinceAug. 11, 2020AvailabilityAcademic Institutions and Nonprofits only -
pFBOH-MHL.BMI1
Plasmid#224711PurposeExpresses N-terminal hexahistidine-tagged human BMI1 (PCGF4) in insect cells.DepositorAvailable SinceOct. 18, 2024AvailabilityAcademic Institutions and Nonprofits only -
hVPS4B-HaloTag Vector
Plasmid#236975PurposeExpress hVPS4B-HaloTag(R) Fusion Protein in Mammalian Cells under a CMV promoterDepositorHas ServiceDNAInserthVPS4B (VPS4B Human)
TagsHaloTag (R)ExpressionMammalianMutationNonePromoterCMVAvailable SinceJuly 14, 2025AvailabilityIndustry, Academic Institutions, and Nonprofits -
pTRIPZ (M)-HT-Cbx2
Plasmid#82510PurposeExpresses Halotag-Cbx2 fusion proteins in mammalian cellsDepositorInsertChromobox Homolog 2 (CBX2 Human)
UseLentiviralTagsHaloTagExpressionMammalianPromoteraggcgtgtacggtgggaggcctatataagcagagctcgtttagtgaacc…Available SinceDec. 1, 2016AvailabilityAcademic Institutions and Nonprofits only -
MAP3K6-TAP
Plasmid#69727PurposeExpress tandem tagged MAP3K6 in cellsDepositorInsertApoptosis signal-regulating kinase 2 (MAP3K6 Human)
TagsHA-V5 tagExpressionMammalianPromoterCMVAvailable SinceOct. 27, 2015AvailabilityAcademic Institutions and Nonprofits only -
TRPML1-EGFP
Plasmid#245039PurposeExpresses TRPML1 with C-terminus EGFP tag in mammalian cellsDepositorAvailable SinceOct. 29, 2025AvailabilityAcademic Institutions and Nonprofits only -
HaloTag-hVPS4B Vector
Plasmid#236976PurposeExpress HaloTag(R)-hVPS4B Fusion Protein in Mammalian Cells under a CMV promoterDepositorHas ServiceDNAInserthVPS4B (VPS4B Human)
TagsHaloTag (R)ExpressionMammalianMutationNonePromoterCMVAvailable SinceJuly 14, 2025AvailabilityIndustry, Academic Institutions, and Nonprofits -
pLV-Enh eGFP Reporter-muKC2-INT1
Plasmid#59286PurposeLentiviral GFP reporter for testing enhancer activity in different cell types. Insert is an enhancer identified in the intronic region of the keratin type II cluster.DepositorInsertKrt7-Intron 2
UseLentiviralPromoterMu Hsp68 minimal promoterAvailable SinceDec. 3, 2014AvailabilityAcademic Institutions and Nonprofits only