We narrowed to 10,433 results for: yeast
-
Plasmid#235731PurposeProtein expression in FL yeast VPS34 D731N mutant in yeastDepositorInsertVPS34
ExpressionYeastMutationS2A, D731NAvailable SinceMay 14, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCY5h
Plasmid#160295PurposeYeast CRISPR plasmid targeting the hphMX cassetteDepositorInsertssgRNA expression cassette (with guide targeting hph: GACCTGATGCAGCTCTCGGA)
URA3 selection cassette
sgRNA expression cassette (without guide)
Cas9
UseCRISPRTags8xHis-tag and SV40 NLSAvailable SinceMarch 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCY5n
Plasmid#160296PurposeYeast CRISPR plasmid targeting the natMX cassetteDepositorInsertssgRNA expression cassette (with guide targeting nat: GTACCGCACCAGTGTCCCGG)
URA3 selection cassette
sgRNA expression cassette (without guide)
Cas9
UseCRISPRTags8xHis-tag and SV40 NLSAvailable SinceMarch 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCY5k
Plasmid#160294PurposeYeast CRISPR plasmid targeting the kanMX cassetteDepositorInsertssgRNA expression cassette (with guide targeting kan: TGTTTTGCCGGGGATCGCAG)
URA3 selection cassette
sgRNA expression cassette (without guide)
Cas9
UseCRISPRTags8xHis-tag and SV40 NLSAvailable SinceMarch 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCas9-EcRT-Z3-Nat
Plasmid#232094PurposeYeast CEN plasmid for estradiol-inducible expression of spCas9 and Ec86 reverse transcriptase.DepositorInsertZ3 promoter and Z3EV transcription factor
UseCRISPRExpressionYeastPromoterZ3Available SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pVG178
Plasmid#227761PurposeExpresses a version of light-inducible transcription factor EL222 (Glu84Lys) under a strong constitutive PGK1prDepositorInsertEL222 codon-optimized for budding yeast
ExpressionYeastMutationGlu84KLys mutantPromoterPGK1prAvailable SinceJan. 15, 2025AvailabilityAcademic Institutions and Nonprofits only -
pVG144
Plasmid#227760PurposeExpresses a version of light-inducible transcription factor EL222 (Val121Met) under a strong constitutive PGK1prDepositorInsertEL222 codon-optimized for budding yeast
ExpressionYeastMutationVal121Met mutantPromoterPGK1prAvailable SinceJan. 15, 2025AvailabilityAcademic Institutions and Nonprofits only -
pVG150
Plasmid#227759PurposeExpresses a version of light-inducible transcription factor EL222 (Ser137Asn) under a strong constitutive PGK1prDepositorInsertEL222 codon-optimized for budding yeast
ExpressionYeastMutationSer137Asn mutantPromoterPGK1prAvailable SinceJan. 15, 2025AvailabilityAcademic Institutions and Nonprofits only -
pVG124
Plasmid#227758PurposeExpresses a version of light-inducible transcription factor EL222 (Thr83Ser) under a strong constitutive PGK1prDepositorInsertEL222 codon-optimized for budding yeast
ExpressionYeastMutationThr83Ser mutantPromoterPGK1prAvailable SinceJan. 15, 2025AvailabilityAcademic Institutions and Nonprofits only -
pVG121
Plasmid#227757PurposeExpresses a version of light-inducible transcription factor EL222 (Gly82Val) under a strong constitutive PGK1prDepositorInsertEL222 codon-optimized for budding yeast
ExpressionYeastMutationGly80Glu mutantPromoterPGK1prAvailable SinceJan. 15, 2025AvailabilityAcademic Institutions and Nonprofits only