We narrowed to 5,623 results for: crispr cas9 grna plasmid
-
Plasmid#71666PurposeExpression of human codon-optimized dCas9-DNMT3A fusion with T2A-EGFP for targeted DNA methylation in mammalian cells; cloning backbone for sgRNADepositorInsertS. pyogenes dCas9 fused with the catalytic domain of human DNMT3A (amino acids P602-V912) and T2A-EGFP (DNMT3A Human, S. pyogenes, Synthetic)
UseCRISPRTags3xFLAG, SV40 NLS, and T2A-EGFPExpressionMammalianMutationD10A and H840A in S.pyogenes Cas9PromoterCBhAvailable sinceMarch 7, 2016AvailabilityAcademic Institutions and Nonprofits only -
pdCas9-DNMT3A-PuroR
Plasmid#71667PurposeExpression of human codon-optimized dCas9-DNMT3A fusion with T2A-PuroR for targeted DNA methylation in mammalian cells; cloning backbone for sgRNADepositorInsertS. pyogenes dCas9 fused with the catalytic domain of human DNMT3A (amino acids P602-V912) and T2A-PuroR (DNMT3A Human, S. pyogenes, Synthetic)
UseCRISPRTags3xFLAG, SV40 NLS, and T2A-PuroRExpressionMammalianMutationD10A and H840A in S.pyogenes Cas9PromoterCBhAvailable sinceMarch 7, 2016AvailabilityAcademic Institutions and Nonprofits only -
pdCas9-DNMT3A-PuroR_v2
Plasmid#74407PurposeExpression of human codon-optimized dCas9-DNMT3A fusion with T2A-PuroR (v2) for targeted DNA methylation in mammalian cells; cloning backbone for sgRNADepositorInsertS. pyogenes dCas9 fused with the catalytic domain of human DNMT3A (amino acids P602-V912) and T2A-PuroR_v2 (DNMT3A Human, S. pyogenes, Synthetic)
UseCRISPRTags3xFLAG, SV40 NLS, and T2A-PuroRExpressionMammalianMutationD10A and H840A in S.pyogenes Cas9PromoterCBhAvailable sinceApril 26, 2016AvailabilityAcademic Institutions and Nonprofits only -
pAAV-FLEX-SaCas9-U6-sgGria1
Plasmid#124853PurposeMutagenesis of Gria1DepositorInsertGria1 (Gria1 Mouse)
UseAAV, CRISPR, and Mouse TargetingTagsExpressionMutationPromoterAvailable sinceMay 6, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAAV-FLEXfrt-SaCas9-U6-sgGria1
Plasmid#124867PurposeMutagenesis of Gria1DepositorInsertGria1 (Gria1 Mouse)
UseAAV, CRISPR, and Mouse TargetingTagsExpressionMutationPromoterAvailable sinceMay 3, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAAV-FLEX-SaCas9-U6-sgGria3
Plasmid#124855PurposeMutagenesis of Gria3DepositorInsertGria3 (Gria3 Mouse)
UseAAV, CRISPR, and Mouse TargetingTagsExpressionMutationPromoterAvailable sinceMay 6, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAAV-FLEXfrt-SaCas9-U6-sgGria3
Plasmid#124869PurposeMutagenesis of Gria3DepositorInsertGria3 (Gria3 Mouse)
UseAAV, CRISPR, and Mouse TargetingTagsExpressionMutationPromoterAvailable sinceMay 6, 2019AvailabilityAcademic Institutions and Nonprofits only -
Lenti-(BB)-EF1a-KRAB-dCas9-P2A-BlastR
Plasmid#118154PurposeCatalytically inactive Cas9 from S. pyogenes with P2A-BlastR under the EF1a core promoter, and cloning backbone for sgRNA. Contains BsmBI sites for insertion of spacer sequences.DepositorInsertKRAB-dCas9-P2A-BlastR
UseCRISPR and LentiviralTagsHAExpressionMammalianMutationSee depositor comments belowPromoterEF1a core and U6Available sinceMarch 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
pGH020_sgRNA_G418-GFP
Plasmid#85405Purposehu6 driven sgRNA vector with G418 and GFP selectable markersDepositorInsertG418 resistance and GFP
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterAvailable sinceDec. 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
pSpCas9(BB)-2A-GFP-G3BP1(2)
Plasmid#136059PurposeG3BP1 gRNA (#2) inserted into the pSpCas9(BB)-2A-GFP plasmid (GTATTACACACTGCTGAACC)DepositorInsertG3BP1 (G3BP1 Human)
UseTagsExpressionMammalianMutationPromoterAvailable sinceFeb. 4, 2020AvailabilityAcademic Institutions and Nonprofits only