We narrowed to 931 results for: plko.1
-
Plasmid#178235PurposeNuclear Protein Barcode (nPC) for vector/cell tracking. Contains U6 trRNA cassette for sgRNA cloning. Enables spatial detection of CRISPR screens.DepositorInsertnPC Tagged mCherry-NLS
UseLentiviralTagsAU1.S.V5 and Nuclear Localization SignalPromotereF1aAvailable sinceJan. 25, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLKO_AU1.Ollas.V5_mCherry-NLS
Plasmid#178233PurposeNuclear Protein Barcode (nPC) for vector/cell tracking. Contains U6 trRNA cassette for sgRNA cloning. Enables spatial detection of CRISPR screens.DepositorInsertnPC Tagged mCherry-NLS
UseLentiviralTagsAU1.Ollas.V5 and Nuclear Localization SignalPromotereF1aAvailable sinceJan. 25, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLKO_AU1.Ollas.VSVg_mCherry-NLS
Plasmid#178232PurposeNuclear Protein Barcode (nPC) for vector/cell tracking. Contains U6 trRNA cassette for sgRNA cloning. Enables spatial detection of CRISPR screens.DepositorInsertnPC Tagged mCherry-NLS
UseLentiviralTagsAU1.Ollas.VSVg and Nuclear Localization SignalPromotereF1aAvailable sinceJan. 25, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLKO_AU1.Ollas.S_mCherry-NLS
Plasmid#178231PurposeNuclear Protein Barcode (nPC) for vector/cell tracking. Contains U6 trRNA cassette for sgRNA cloning. Enables spatial detection of CRISPR screens.DepositorInsertnPC Tagged mCherry-NLS
UseLentiviralTagsAU1.Ollas.S and Nuclear Localization SignalPromotereF1aAvailable sinceJan. 25, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLKO_AU1.NWS.V5_mCherry-NLS
Plasmid#178230PurposeNuclear Protein Barcode (nPC) for vector/cell tracking. Contains U6 trRNA cassette for sgRNA cloning. Enables spatial detection of CRISPR screens.DepositorInsertnPC Tagged mCherry-NLS
UseLentiviralTagsAU1.NWS.V5 and Nuclear Localization SignalPromotereF1aAvailable sinceJan. 25, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLKO_AU1.NWS.VSVg_mCherry-NLS
Plasmid#178229PurposeNuclear Protein Barcode (nPC) for vector/cell tracking. Contains U6 trRNA cassette for sgRNA cloning. Enables spatial detection of CRISPR screens.DepositorInsertnPC Tagged mCherry-NLS
UseLentiviralTagsAU1.NWS.VSVg and Nuclear Localization SignalPromotereF1aAvailable sinceJan. 25, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLKO_AU1.NWS.S_mCherry-NLS
Plasmid#178228PurposeNuclear Protein Barcode (nPC) for vector/cell tracking. Contains U6 trRNA cassette for sgRNA cloning. Enables spatial detection of CRISPR screens.DepositorInsertnPC Tagged mCherry-NLS
UseLentiviralTagsAU1.NWS.S and Nuclear Localization SignalPromotereF1aAvailable sinceJan. 25, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLKO_AU1.NWS.Ollas_mCherry-NLS
Plasmid#178227PurposeNuclear Protein Barcode (nPC) for vector/cell tracking. Contains U6 trRNA cassette for sgRNA cloning. Enables spatial detection of CRISPR screens.DepositorInsertnPC Tagged mCherry-NLS
UseLentiviralTagsAU1.NWS.Ollas and Nuclear Localization SignalPromotereF1aAvailable sinceJan. 25, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLKO_AU1.HSV.V5_mCherry-NLS
Plasmid#178226PurposeNuclear Protein Barcode (nPC) for vector/cell tracking. Contains U6 trRNA cassette for sgRNA cloning. Enables spatial detection of CRISPR screens.DepositorInsertnPC Tagged mCherry-NLS
UseLentiviralTagsAU1.HSV.V5 and Nuclear Localization SignalPromotereF1aAvailable sinceJan. 25, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLKO_AU1.HSV.NWS_mCherry-NLS
Plasmid#178222PurposeNuclear Protein Barcode (nPC) for vector/cell tracking. Contains U6 trRNA cassette for sgRNA cloning. Enables spatial detection of CRISPR screens.DepositorInsertnPC Tagged mCherry-NLS
UseLentiviralTagsAU1.HSV.NWS and Nuclear Localization SignalPromotereF1aAvailable sinceJan. 25, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLKO_AU1.HA.NWS_mCherry-NLS
Plasmid#178217PurposeNuclear Protein Barcode (nPC) for vector/cell tracking. Contains U6 trRNA cassette for sgRNA cloning. Enables spatial detection of CRISPR screens.DepositorInsertnPC Tagged mCherry-NLS
UseLentiviralTagsAU1.HA.NWS and Nuclear Localization SignalPromotereF1aAvailable sinceJan. 25, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLKO_V5.AU1.C_NGFR
Plasmid#158255PurposeProtein Barcode (Pro-Code) for vector/cell tracking. Contains U6 trRNA cassette for sgRNA cloning. Enables phenotypic CRISPR screens at a single cell resolution (using cytometry).DepositorInsertPro-Code Tagged human dNGFR (NGFR Human)
UseCRISPR and LentiviralTagsV5.AU1.CMutationTruncation of the signaling domainPromoterEF1aAvailable sinceSept. 3, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLKO-Tet-puro-hARAF-shRNA-1
Plasmid#185370PurposeFor tetracycline-inducible mammalian expression of shRNA: GCCGTGACCAGATTATCTTTA that targets human ARAFDepositorAvailable sinceJune 8, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLH-sgRNA-Sirius-8XPP7
Plasmid#121940PurposeCRISPR-Sirius plasmidDepositorInsertsgRNA-Sirius-8XPP7
UseCRISPR and LentiviralTagsnoExpressionMammalianPromoterhuman U6 promoterAvailable sinceFeb. 8, 2019AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pEJS613_pTetR-P2A-BFPnls/sgTelo
Plasmid#108649PurposeTelomere-targeting Spy sgRNA under U6 promoterDepositorInsertsTelomere-targeting sgRNA
TetR-P2A-BFP
UseCRISPR and LentiviralTagsNoExpressionMammalianPromoterU6 and hPGKAvailable sinceMay 9, 2018AvailabilityAcademic Institutions and Nonprofits onlyCited by -
ERK-KTR-mStrawberry reporter
Plasmid#158686PurposeThis plasmid is a ERK pathway reporter. It has CMV promoter driving the expression of ERK-KTR fused to mStrawberry-pGK-BSDDepositorInsertmStrawberry
UseLentiviralExpressionMammalianPromoterCMVAvailable sinceMay 18, 2022AvailabilityAcademic Institutions and Nonprofits only -
mSin1 shRNA #2
Plasmid#13484DepositorAvailable sinceNov. 22, 2006AvailabilityAcademic Institutions and Nonprofits onlyCited by -
AKT-translocation-mStrawberry reporter
Plasmid#158685PurposeThis plasmid is a AKT pathway reporter. It has 1EF1a promoter driving the expression of truncated FoxO1 fused to mStrawberry-pGK-BSDDepositorInsertmStrawberry
UseLentiviralExpressionMammalianPromoterEF1aAvailable sinceMay 18, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLH-sgRNA-Sirius-4X(MS2-PP7)
Plasmid#121941PurposeCRISPR-Sirius plasmidDepositorInsertsgRNA-Sirius-4X(MS2-PP7)
UseCRISPR and LentiviralTagsnoExpressionMammalianPromoterhuman U6 promoterAvailable sinceFeb. 8, 2019AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pEJS1084_pTetR-P2A-BFP/BspMI flexible sgRNA
Plasmid#117687PurposeU6 driven Spy sgRNA cloning vector where guide sequences are inserted between BspMI sites. This plasmid works with Addgene #108570 for subnuclear proteomic profiling via C-BERST method.DepositorInsertsKanamycin cassette
TetR-P2A-BFP
UseCRISPR and LentiviralExpressionMammalianPromoterU6 and hPGKAvailable sinceDec. 17, 2018AvailabilityAcademic Institutions and Nonprofits only