We narrowed to 12,071 results for: shRNA
-
Plasmid#239931PurposesgRNA compatible with TCTP-SynPro-10 as Level-0 part (Golden Gate cloning)DepositorInsertsgRNA
UseSynthetic BiologyMutationN/AAvailable SinceSept. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
PB-U6-CNCB_sgSOX2
Plasmid#242175PurposeA piggybac-based vector containing mouse U6 promoter-driven SOX2 sgRNA and CAG promoter-driven nuclear-localized Clover-T2A-BSR.DepositorAvailable SinceSept. 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
PB-U6-CNCB_sgPOU5F1
Plasmid#242174PurposeA piggybac-based vector containing mouse U6 promoter-driven POU5F1sgRNA and CAG promoter-driven nuclear-localized Clover-T2A-BSR.DepositorAvailable SinceSept. 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pDS48
Plasmid#241839PurposeCas9-gRNA construct targeting the UBE3A locusDepositorAvailable SinceSept. 8, 2025AvailabilityAcademic Institutions and Nonprofits only -
pENTR221-ITGB1(no stop)
Plasmid#215453PurposeGateway entry vector with integrin beta1 wild-type (WT) without a stop codonDepositorInsertITGB1 (ITGB1 Human)
UseGateway entry vectorMutationSilent mutations added to disrupt shRNA binding a…PromoternoneAvailable SinceSept. 4, 2025AvailabilityIndustry, Academic Institutions, and Nonprofits -
pAAV-U6-DR30(SapI)-CMV-intron-MCS-pA
Plasmid#192496PurposeTo express CasRX gRNA and contains MCS to insert coding region of interestDepositorInsertCasRx
UseAAVMutationNoPromoterCMVAvailable SinceAug. 27, 2025AvailabilityAcademic Institutions and Nonprofits only -
pX458-ARHGEF7/B-Pix
Plasmid#241368PurposeMammalian expression of SpCas9 and gRNA targeting ARHGEF7 (β-Pix)DepositorAvailable SinceAug. 27, 2025AvailabilityAcademic Institutions and Nonprofits only -
pdU6-2_sgRNA-d5-HT1AR
Plasmid#221820PurposePlasmid to express gRNA (gaccagtccactaccgcagc) for editing at the end of Drosophila 5-HT1AR coding frameDepositorAvailable SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pdU6-2_sgRNA1-d5-HT1BR
Plasmid#221821PurposePlasmid to express gRNA1 (gaaaatttgatttcaactga) for editing at the end of Drosophila 5-HT1BR coding frameDepositorInsertd5-HT1BR gRNA1 (5-HT1B Fly)
UseCRISPRExpressionInsectPromoterzebrafish U6 promoter (U6b)Available SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pdU6-2_sgRNA2-5-HT1BR
Plasmid#221822PurposePlasmid to express gRNA2 (aatttcgacgggccttcaag) for editing at the end of Drosophila 5-HT1BR coding frameDepositorAvailable SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pdU6-2_sgRNA1-5-HT2AR-isoformD
Plasmid#221823PurposePlasmid to express gRNA1 (tccttctggcgcaaacacgg) for editing at the end of Drosophila 5-HT2AR isoform D coding frameDepositorInsertd5-HT2AR isoform D gRNA1 (5-HT2 Fly)
UseCRISPRExpressionInsectPromoterDrosophila U6 promoterAvailable SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pdU6-2_sgRNA2-5-HT2AR-isoformD
Plasmid#221824PurposePlasmid to express gRNA2 (ctgaagacataattacgtgg) for editing at the end of Drosophila 5-HT2AR isoform D coding frameDepositorInsertd5-HT2AR isoform D gRNA2 (5-HT2 Fly)
UseCRISPRExpressionInsectPromoterzebrafish U6 promoter (U6b)Available SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pdU6-2_sgRNA1-5-HT2AR-isoformBFH
Plasmid#221825PurposePlasmid to express gRNA1 (cgctatcggtctgtgacaga) for editing at the end of Drosophila 5-HT2AR isoforms B, F and H coding frameDepositorInsertd5-HT2AR isoforms BFH gRNA1 (5-HT2 Fly)
UseCRISPRExpressionInsectPromoterzebrafish U6 promoter (U6b)Available SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pdU6-2_sgRNA2-5-HT2AR-isoformBFH
Plasmid#221826PurposePlasmid to express gRNA2 (ggaaaagccgctaattacag) for editing at the end of Drosophila 5-HT2AR isoforms B, F and H coding frameDepositorInsertd5-HT2AR isoforms BFH gRNA2 (5-HT2 Fly)
UseCRISPRExpressionInsectPromoterDrosophila U6 promoterAvailable SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pdU6-2_sgRNA-d5-HT7R
Plasmid#221829PurposePlasmid to express gRNA (ggcgagggagagctttctct) for editing at the end of Drosophila 5-HT1AR coding frameDepositorAvailable SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
PX459_NRF2-exon5-1
Plasmid#177781PurposesgRNA for CRISPR/Cas9-mediated deletion of human NRF2DepositorInsertNRF2 (NFE2L2 Human)
UseCRISPRAvailable SinceAug. 6, 2025AvailabilityAcademic Institutions and Nonprofits only -
PX459_NRF2-exon5-2
Plasmid#177782PurposesgRNA for CRISPR/Cas9-mediated deletion of human NRF2DepositorInsertNRF2 (NFE2L2 Human)
UseCRISPRAvailable SinceAug. 6, 2025AvailabilityAcademic Institutions and Nonprofits only -
pRCA893 - pBA904 Puro-T2A-BFP KLF5 g1 CRISPRa guide guide (pRCA594 backbone) 666
Plasmid#238186PurposeLentiviral CRISPR guide vector expressing a KLF5 sgRNA with cs1 incorporated in the loop of the sgRNA constant region for 10X Direct CaptureDepositorAvailable SinceAug. 6, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV- GfaABC1D::Cas9-HA-sgRNA-Non-Targeting
Plasmid#241026PurposeGfaABC1D promoter driven HA-tagged SaCas9 together with U6 driven expression of a non-targeting sgRNA; used as control for SaCas9 based knock-outs in murine astrocytesDepositorInsertU6 driven empty sgRNA
UseAAV and CRISPRTagsSaCas9 + 3X HA-TagExpressionMammalianPromoterGfaABC1DAvailable SinceAug. 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
LentiCRISPR-B_2xsgRNAs_RPPH1 (pAVA3586)
Plasmid#239328PurposeLentiviral vector expressing Cas9-P2A-Blasticidin and two sgRNAs targeting RPPH1DepositorInsertU6-driven sgRNA1 and 7SK-driven sgRNA2 targeting RPPH1 (RPPH1 Human)
UseCRISPR and LentiviralAvailable SinceAug. 4, 2025AvailabilityAcademic Institutions and Nonprofits only