We narrowed to 12,280 results for: shRNA
-
Plasmid#232894PurposePlasmid expressing Cas9 and gRNA GTTCTTAACTAGGATCATGG which targets the RER2 gene.DepositorAvailable SinceFeb. 26, 2025AvailabilityAcademic Institutions and Nonprofits only
-
pML104-HygMx4-URA3-3
Plasmid#232886PurposePlasmid expressing Cas9 and gRNA GAAGTAACAAAGGAACCTAG which targets the URA3 gene.DepositorAvailable SinceFeb. 26, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML104-HygMx4-URA3-2
Plasmid#232885PurposePlasmid expressing Cas9 and gRNA TCGTACCACCAAGGAATTAC which targets the URA3 gene.DepositorAvailable SinceFeb. 26, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-AVO1
Plasmid#232889PurposePlasmid expressing Cas9 and gRNA AATGATGACGACCATACCAG which targets the AVO1 gene.DepositorAvailable SinceFeb. 21, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-YFR054C
Plasmid#232900PurposePlasmid expressing Cas9 and gRNA GCTCAAAGAAACAATTAGAG which targets the YFR054C gene.DepositorAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-ZIM17
Plasmid#232901PurposePlasmid expressing Cas9 and gRNA AAATGTCTCACTTTGCAGTG which targets the ZIM17 gene.DepositorAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-SRP14
Plasmid#232896PurposePlasmid expressing Cas9 and gRNA GAAAACAAAATGCTCAACAG which targets the SRP14 gene.DepositorAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-TLG1
Plasmid#232897PurposePlasmid expressing Cas9 and gRNA GATGAAAACGAAGACGTGAG which targets the TLG1 gene.DepositorAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-VHT1
Plasmid#232898PurposePlasmid expressing Cas9 and gRNA TGCGGCCACACTGAAATACG which targets the VHT1 gene.DepositorAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-ADE13
Plasmid#232887PurposePlasmid expressing Cas9 and gRNA GTAGCAGCAAAAGAAGACAA which targets the ADE13 gene.DepositorAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-LAS17
Plasmid#232892PurposePlasmid expressing Cas9 and gRNA AATACCCTGAATTCTGCCGG which targets the LAS17 gene.DepositorAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
PE-pegRNA(BG)-nsgRNA(BG)
Plasmid#232727PurposeA dual-targeting vector that contains PE3 system guide RNAs against BFP (pegRNA(BG) and nsgRNA(BG)) with restriction enzyme sites for insertion of target site guide RNAS (pegRNAs(TS) and nsgRNA(TS)).DepositorInsertpegRNA(BG), nsgRNA(BG), pegRNAs(TS), nsgRNA(TS)
UseCRISPRExpressionMammalianPromoterU6Available SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML104-LEU2-2
Plasmid#232883PurposePlasmid expressing Cas9 and gRNA GGTAGTGTTAGACCTGAACA which targets the LEU2 gene.DepositorAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-INO80
Plasmid#232890PurposePlasmid expressing Cas9 and gRNA GGAAGTAGAATCATTCGTAG which targets the INO80 gene.DepositorAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLentiCRISPR-v1-sgABCC4_1
Plasmid#217433PurposeLentiviral vector expressing Cas9 and an sgRNA targeting human ABCC4DepositorInsertsgRNA 1 targeting ABCC4 (ABCC4 Human)
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceJan. 31, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLentiCRISPR-v1-sgABCC4_3
Plasmid#217434PurposeLentiviral vector expressing Cas9 and an sgRNA targeting human ABCC4DepositorInsertsgRNA 3 targeting ABCC4 (ABCC4 Human)
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceJan. 31, 2025AvailabilityAcademic Institutions and Nonprofits only -
LCV2 PQBP1 KO2
Plasmid#217448PurposeLentiviral vector expressing Cas9 and an sgRNA targeting human PQBP1DepositorAvailable SinceJan. 28, 2025AvailabilityAcademic Institutions and Nonprofits only -
LCV2 PQBP1 KO1
Plasmid#217447PurposeLentiviral vector expressing Cas9 and an sgRNA targeting human PQBP1DepositorAvailable SinceJan. 28, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-EFS-TadA8e-Sauri-U6-Camk2d sgRNA1
Plasmid#220117PurposeExpresses SauriABE8e by EFS promoter and sgRNA targeting murine Camk2d start codon site by U6 promoterDepositorInsertTadA8e, nSauriCas9
UseAAVPromoterEFSAvailable SinceJan. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-EFS-TadA8e-Sauri-U6-Camk2d sgRNA6
Plasmid#220118PurposeExpresses SauriABE8e by EFS promoter and sgRNA targeting murine Camk2d intron6 5' splice site by U6 promoterDepositorInsertTadA8e, nSauriCas9
UseAAVPromoterEFSAvailable SinceJan. 16, 2025AvailabilityAcademic Institutions and Nonprofits only