We narrowed to 12,071 results for: shRNA
-
Plasmid#196612PurposeEncoding guide RNAs for the knock out of TPS1 and GSY2 genesDepositorAvailable SinceMarch 23, 2023AvailabilityAcademic Institutions and Nonprofits only
-
pAAV-U6-DR30(sapI)-CMV-intron-hfCas13d-pA
Plasmid#195865PurposeTo express hfCas13dDepositorInserthigh fidelity (hf) version of CasRx (hfCas13d)
UseAAVMutationYes: GTGGAATACATTACCAACGTGGTGTACGTGPromoterCMVAvailable SinceJan. 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pXPR_003 sgINTS12 guide 2
Plasmid#193607PurposeINTS12 knockoutDepositorInsertsgINTS12 guide 2 (INTS12 Human)
UseLentiviralAvailable SinceJan. 3, 2023AvailabilityAcademic Institutions and Nonprofits only -
pXPR_003 sgINTS12 guide 1
Plasmid#193606PurposeINTS12 knockoutDepositorInsertsgINTS12 guide 1 (INTS12 Human)
UseLentiviralAvailable SinceJan. 3, 2023AvailabilityAcademic Institutions and Nonprofits only -
pXPR_003 sgRELA guide 2
Plasmid#193592PurposeRELA knockoutDepositorInsertsgRELA guide 2 (RELA Human)
UseLentiviralAvailable SinceJan. 3, 2023AvailabilityAcademic Institutions and Nonprofits only -
eSpCas9-EF-5Flnc
Plasmid#174870PurposeCRISPR vector for generating Flnc STREAMING-tag KI cellDepositorInsertsgRNA for mouse Flnc (Flnc Synthetic)
UseCRISPRAvailable SinceDec. 22, 2022AvailabilityAcademic Institutions and Nonprofits only -
eSpCas9-EF-5Usp5
Plasmid#174873PurposeCRISPR vector for generating Usp5 STREAMING-tag KI cellDepositorInsertsgRNA for mouse Usp5 (Usp5 Synthetic)
UseCRISPRAvailable SinceDec. 22, 2022AvailabilityAcademic Institutions and Nonprofits only -
eSpCas9-EF-5Wnk1
Plasmid#174874PurposeCRISPR vector for generating Wnk1 STREAMING-tag KI cellDepositorInsertsgRNA for mouse Wnk1 (Wnk1 Synthetic)
UseCRISPRAvailable SinceDec. 22, 2022AvailabilityAcademic Institutions and Nonprofits only -
pX330A-Yap1-E1-#2
Plasmid#171519Purposedeletion of a genomic locus in Yap1 geneDepositorAvailable SinceNov. 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
pX459-dTLN1 exon
Plasmid#176033PurposeA vector for the CRISPR-Cas9 system targeting an exon of dog TLN1 (talin1)DepositorInsertA gRNA targeting the dog TLN1 gene and the cDNA of Cas9 (TLN1 )
UseCRISPRExpressionMammalianAvailable SinceOct. 27, 2022AvailabilityAcademic Institutions and Nonprofits only -
pX459-dTLN1 intron
Plasmid#176224PurposeA vector for the CRISPR-Cas9 system targeting an intron of dog TLN1 (talin1)DepositorInsertA gRNA targeting the dog TLN1 gene and the cDNA of Cas9 (TLN1 )
UseCRISPRExpressionMammalianAvailable SinceOct. 27, 2022AvailabilityAcademic Institutions and Nonprofits only -
pSLQ1373_mU6_sgRNA targeting e1
Plasmid#190684PurposesgRNA targeting enhancer 1 of MYCDepositorInsertsgRNA targeting enhancer 1 of MYC
UseCRISPR, Lentiviral, and Synthetic BiologyTagsBFP and PuromycinExpressionMammalianPromotermouse U6 promoterAvailable SinceOct. 19, 2022AvailabilityAcademic Institutions and Nonprofits only -
double_sgRNA targeting e1 and e4
Plasmid#190688PurposesgRNAs targeting enhancer 1 and 4 of MYC separatelyDepositorInsertsgRNAs targeting enhancer 1 and 4 of MYC separately
UseCRISPR, Lentiviral, and Synthetic BiologyTagsBFP and PuromycinExpressionMammalianAvailable SinceOct. 19, 2022AvailabilityAcademic Institutions and Nonprofits only -
pSLQ5004_hU6_sgRNA targeting e7
Plasmid#190687PurposesgRNA targeting enhancer 7 of MYCDepositorInsertsgRNA targeting enhancer 7 of MYC
UseCRISPR, Lentiviral, and Synthetic BiologyTagsBFP and PuromycinExpressionMammalianPromoterHuman U6 promoterAvailable SinceOct. 19, 2022AvailabilityAcademic Institutions and Nonprofits only -
pSLQ5004_hU6_sgRNA targeting e4
Plasmid#190686PurposesgRNA targeting enhancer 4 of MYCDepositorInsertsgRNA targeting enhancer 4 of MYC
UseCRISPR, Lentiviral, and Synthetic BiologyTagsBFP and PuromycinExpressionMammalianPromoterHuman U6 promoterAvailable SinceOct. 19, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLenti-v2-ALDH1A3gRNA2
Plasmid#189747PurposeThe construct was used for expression of gRNA and Cas9 for knocking out of the ALDH1A3 gene.DepositorInsertCas9, ALDH1A3 gRNA
UseCRISPRPromoterU6Available SinceOct. 19, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLenti-ALDH1A3gRNA3
Plasmid#189748PurposeThe construct was used for expression of gRNA for knocking out of the ALDH1A3 gene in Cas9 expressing cells.DepositorInsertALDH1A3 gRNA
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceOct. 19, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLenti-v2-ALDH1A3gRNA1
Plasmid#189746PurposeThe construct was used for expression of gRNA and Cas9 for knocking out of the ALDH1A3 gene.DepositorInsertCas9, ALDH1A3 gRNA
UseCRISPRPromoterU6Available SinceOct. 19, 2022AvailabilityAcademic Institutions and Nonprofits only -
pSLQ1373_mU6_sgRNA targeting e3
Plasmid#190685PurposesgRNA targeting enhancer 3 of MYCDepositorInsertsgRNA targeting enhancer 3 of MYC
UseCRISPR, Lentiviral, and Synthetic BiologyTagsBFP and PuromycinExpressionMammalianPromotermouse U6 promoterAvailable SinceOct. 19, 2022AvailabilityAcademic Institutions and Nonprofits only -
bu6-sgCebpa_v1-mU6-sgCebpb_v1-hU6-sgCebpd_v1
Plasmid#177257PurposeExpresses Cebpa_v1 (bU6), Cebpb_v1 (mU6), Cebpd_v1 (hU6) gRNAs and Cre-recombinaseDepositorInsertsgCebpa_v1/sgCebpb_v1/sgCebpd_v1
UseLentiviralPromoterbU6/mU6/hU6Available SinceOct. 3, 2022AvailabilityAcademic Institutions and Nonprofits only