We narrowed to 28,314 results for: CAL;
-
Plasmid#184818PurposeUsed to synthesize gRNA targeting exon 2 of the gsc2 geneDepositorInsertgsc2-sgRNA
UseCRISPR; Template for sgrna synthesisAvailable SinceMay 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
-
-
pDestTol2-QUAS:NLS-GFP-he1.1:CFP
Plasmid#184815PurposeUsed to generate the Tg(QUAS:NLS-GFP; he1.1:CFP)c682 transgenic lineDepositorInsertQUAS:NLS-GFP-pA; he1.1:CFP
UseZebrafish tol2 transgenesisTagsNLS-GFPAvailable SinceMay 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
PE-SUMO CRYBA4
Plasmid#217671PurposeFor expression of SUMO tagged human beta A4 crystallinDepositorAvailable SinceMay 11, 2024AvailabilityAcademic Institutions and Nonprofits only -
F23-pAc5.1 EGFP Cup
Plasmid#206488PurposeCup expression for Schneider cell imagingDepositorInsertCup
TagsEGFPExpressionInsectAvailable SinceMay 8, 2024AvailabilityAcademic Institutions and Nonprofits only -
F17-pAc5.1 EGFP Vasa 1-200
Plasmid#206484Purposevasa 1-200 expression for Schneider cell imagingDepositorInsertVasa 1-200
TagsEGFPExpressionInsectAvailable SinceMay 8, 2024AvailabilityAcademic Institutions and Nonprofits only -
SHLD3 N-terminal sgRNA
Plasmid#207094PurposepX330 based plasmid for expression of Cas9 and the TTACTGCAGAATGACTACAG sgRNA to target the SHLD3 locus.DepositorInsertTTACTGCAGAATGACTACAG
ExpressionMammalianPromoterCMV and U6Available SinceMay 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
NBS1 C-terminal sgRNA
Plasmid#207092PurposepX330 based plasmid for expression of Cas9 and the TAAAAAGGAGAAGATAACTG sgRNA to target the NBS1 locus.DepositorInsertTAAAAAGGAGAAGATAACTG
ExpressionMammalianPromoterCMV and U6Available SinceMay 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
RNF169 C-terminal sgRNA
Plasmid#207099PurposepX330 based plasmid for expression of Cas9 and the ACACTTCATTAGGTGCTACT sgRNA to target the RNF169 locus.DepositorInsertACACTTCATTAGGTGCTACT
ExpressionMammalianPromoterCMV and U6Available SinceMay 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
SHLD1 N-terminal sgRNA
Plasmid#207101PurposepX330 based plasmid for expression of Cas9 and the ATGGCAGGACTATGGCAGCC sgRNA to target the SHLD1 locus.DepositorInsertATGGCAGGACTATGGCAGCC
ExpressionMammalianPromoterCMV and U6Available SinceMay 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
ATM C-terminal sgRNA
Plasmid#207097PurposepX330 based plasmid for expression of Cas9 and the TTTCTAAAGGCTGAATGAAA sgRNA to target the ATM locus.DepositorInsertTTTCTAAAGGCTGAATGAAA
ExpressionMammalianPromoterCMV and U6Available SinceMay 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
pIRESneo-FLAG/HA-FL
Plasmid#215839PurposeExpression of FLAG/HA tagged firefly luciferase (FL)DepositorInsertFLAG/HA tagged firefly luciferase (FL)
ExpressionMammalianAvailable SinceApril 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
psiCHECK1-CXCR4-MM4
Plasmid#215846PurposeExpression of CXCR4 target with mismatch (MM) 4_DepositorInsertCXCR4 target with mismatch (MM) 4x
ExpressionMammalianAvailable SinceApril 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
SHLD3 KO sgRNA #1
Plasmid#207105PurposepX330 based plasmid for expression of Cas9 and the CGCTATCAAGATTTATACCT sgRNA to target the SHLD3 locus..DepositorInsertCGCTATCAAGATTTATACCT
ExpressionMammalianPromoterCMV and U6Available SinceApril 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
psiCHECK1-CXCR4
Plasmid#215845PurposeExpression of CXCR4 target with perfect-match siteDepositorInsertCXCR4 target with perfect-match site
ExpressionMammalianAvailable SinceApril 17, 2024AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1-FLAG/HA-p54
Plasmid#215844PurposeExpression of FLAG/HA-p54DepositorInsertHuman p54
ExpressionMammalianAvailable SinceApril 17, 2024AvailabilityAcademic Institutions and Nonprofits only -
pUdO1s
Plasmid#210238Purposehigh-copy plasmid for bacterial expressionDepositorTypeEmpty backboneExpressionBacterialAvailable SinceApril 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
pUdO2te
Plasmid#210243Purposemedium-copy plasmid for bacterial expressionDepositorTypeEmpty backboneExpressionBacterialAvailable SinceApril 11, 2024AvailabilityAcademic Institutions and Nonprofits only -
pUdOanc-a
Plasmid#210320Purposehigh-copy plasmid for bacterial expressionDepositorTypeEmpty backboneExpressionBacterialAvailable SinceApril 11, 2024AvailabilityAcademic Institutions and Nonprofits only