We narrowed to 8,420 results for: chloramphenicol
-
Plasmid#78277PurposemRFP1 behind constitutive promoter J23110 in pSEVA331Bb backboneDepositorInsertJ23110-mRFP1
Available SinceNov. 10, 2016AvailabilityAcademic Institutions and Nonprofits only -
pPRIME-CMV-GFP-shDyn1
Plasmid#132711PurposeEncodes short hairpin RNA (shRNA) #1 that targets the 3’-untranslated region of the rat Pdyn geneDepositorAvailable SinceOct. 25, 2019AvailabilityAcademic Institutions and Nonprofits only -
MTK234_055
Plasmid#123920PurposeEncodes the spCas9 gRNA GFP dropout expression cassette (bovine u6 promoter and constant region 2) as a type 234 part to be used in the MTK systemDepositorInsertgRNA-GFPDROPOUT-for Sp Cas9 bu6_20N_cr2
ExpressionMammalianAvailable SinceDec. 13, 2019AvailabilityAcademic Institutions and Nonprofits only -
J23112-mRFP1-331Bb
Plasmid#78278PurposemRFP1 behind constitutive promoter J23112 in pSEVA331Bb backboneDepositorInsertJ23112-mRFP1
Available SinceNov. 10, 2016AvailabilityAcademic Institutions and Nonprofits only -
J23103-mRFP1-331Bb
Plasmid#78273PurposemRFP1 behind constitutive promoter J23103 in pSEVA331Bb backboneDepositorInsertJ23103-mRFP1
Available SinceNov. 10, 2016AvailabilityAcademic Institutions and Nonprofits only -
J23105-mRFP1-331Bb
Plasmid#78275PurposemRFP1 behind constitutive promoter J23105 in pSEVA331Bb backboneDepositorInsertJ23105-mRFP1
Available SinceNov. 10, 2016AvailabilityAcademic Institutions and Nonprofits only -
pPRIME-CMV-GFP-shCrh1
Plasmid#132709PurposeEncodes short hairpin RNA (shRNA) #1 that targets the 3’-untranslated region of the rat Crh geneDepositorAvailable SinceOct. 31, 2019AvailabilityAcademic Institutions and Nonprofits only -
J23101-mRFP1-331Bb
Plasmid#78272PurposemRFP1 behind constitutive promoter J23101 in pSEVA331Bb backboneDepositorInsertJ23101-mRFP1
Available SinceNov. 10, 2016AvailabilityAcademic Institutions and Nonprofits only -
pTet02
Plasmid#78284PurposemRFP1 expressed behind an ATc-inducible constructDepositorInsertTet inducible mRFP1
Available SinceNov. 10, 2016AvailabilityAcademic Institutions and Nonprofits only -
-
-
pACYCDuet-ΔHsFBXO28-Myc-MBP-HA
Plasmid#228946PurposeExpression ΔHsFBXO28-Myc (lacking F-box domain) and MBP-HA in in bacterial cellsDepositorAvailable SinceMarch 10, 2026AvailabilityAcademic Institutions and Nonprofits only -
FUCGW-DEST
Plasmid#208408PurposeLentivirus compatible with LR Gateway cloning for UBC-driven gene expression with CMV-GFP in backboneDepositorArticleTypeEmpty backboneUseLentiviral; Gateway: dest vectorPromoterUBCAvailable SinceJan. 29, 2026AvailabilityAcademic Institutions and Nonprofits only -
FUCRW-DEST
Plasmid#208409PurposeLentivirus compatible with LR Gateway cloning for UBC-driven gene expression with CMV-RFP in backboneDepositorArticleTypeEmpty backboneUseLentiviral; Gateway: dest vectorPromoterUBCAvailable SinceJan. 29, 2026AvailabilityAcademic Institutions and Nonprofits only -
MB 103C ttrSR(m13)-Bxb1_P7-sfGFP_mCherry
Plasmid#232475PurposeOptimized tetrathionate sensor with recombinase switch and fluorescent reporter (GFP), constitutive mCherryDepositorInsertsttrS
ttrR
PttrB185-269
sfGFP
AxeTxe
mCherry
Bxb1 integrase
TagsssrA degradation tagExpressionBacterialPromoterConstitutive (TTGATAGCTAGCTCAGTCCTAGGTATTGTGCTAGC…Available SinceNov. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pME_Cp_0_2-3a_004_atpA_Promoter+5'UTR_Cr
Plasmid#235876PurposeatpA promoter + 5'UTR Chlamydomonas reinhardtii 2-3aDepositorInsertatpA promoter + 5'UTR
UseSynthetic BiologyAvailable SinceOct. 7, 2025AvailabilityAcademic Institutions and Nonprofits only -
pME_G_0_2-3_005_Promoter+5'UTR_Placeholder
Plasmid#235870PurposeEncodes a sfGFP cassette in the promoter+5'UTR position used for placeholder cloningDepositorInsertPromoter + 5'UTR placeholder
UseSynthetic BiologyMutationnoneAvailable SinceOct. 6, 2025AvailabilityAcademic Institutions and Nonprofits only -
pEvol-chKlacRS-WT
Plasmid#232159PurposeA chimeric PylRS for site-specific incorporation of L-lactyl-lysine into target proteins in E.coli cells.DepositorInsertchKlacRS-WT
UseSynthetic BiologyExpressionBacterialAvailable SinceJuly 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
pEvol-chKlacRS-IPYE
Plasmid#232160PurposeA chimeric PylRS for site-specific incorporation of L-lactyl-lysine into target proteins in E.coli cells.DepositorInsertchKlacRS-IPYE
UseSynthetic BiologyExpressionBacterialAvailable SinceJuly 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
pWal10-roe-sfGFP
Plasmid#240239PurposeGateway destination plasmid to generate C-terminal sfGFP fusions under control of UAS promoter. Can be used to generate transgenic fly lines by white+ fly eye selection and phiC31 integration.DepositorTypeEmpty backboneUseGateway destination vectorExpressionInsectAvailable SinceJuly 11, 2025AvailabilityAcademic Institutions and Nonprofits only