We narrowed to 15,703 results for: jun
-
Plasmid#221740PurposeStable expression of GFP-5K4Q in mammalian cells to monitor membrane chargeDepositorInsertC -terminal region of KRAS (KRAS Human)
UseRetroviralTagsGFPExpressionMammalianMutationdeleted amino acids 1-170, mutated K to QAvailable sinceAug. 26, 2024AvailabilityAcademic Institutions and Nonprofits only -
pQA-LP580
Plasmid#222959PurposeExpresses R141S K142S LoaP double mutantDepositorInsertantiterminator protein LoaP
Tags10xHIS-SUMOExpressionBacterialMutationmutated Arginine 141 to Serine and Lysine 142 to …PromoterT7Available sinceAug. 7, 2024AvailabilityAcademic Institutions and Nonprofits only -
pQA-LP579
Plasmid#222958PurposeExpresses R36S K51S LoaP double mutantDepositorInsertantiterminator protein LoaP
Tags10xHIS-SUMOExpressionBacterialMutationmutated Arginine 36 to Serine and Lysine 51 to Se…PromoterT7Available sinceAug. 7, 2024AvailabilityAcademic Institutions and Nonprofits only -
pPtet-1_mNeonGreen_Ptet-2_mCherry
Plasmid#213839PurposeExpression of mNeonGreen and mCherry from aTc-inducible Ptet promoters.DepositorInsertmNeonGreen, mCherry
ExpressionYeastAvailable sinceJune 21, 2024AvailabilityAcademic Institutions and Nonprofits only -
pReporter_TetR
Plasmid#213847PurposeFacilitates genomic integration of tetR expression cassette.DepositorInsertTetR
ExpressionYeastAvailable sinceJune 21, 2024AvailabilityAcademic Institutions and Nonprofits only -
pIVEX2.3-AC17-5c-frGFP
Plasmid#217525PurposeAC17-5c riboswitch-regulated GFP reporter. The gene is inserted into downstream of T7 promoter.DepositorInsertAC17-5c riboswitch-regulated folding reporter GFP
UseIn vitro transcription-translationPromoterT7Available sinceMay 16, 2024AvailabilityAcademic Institutions and Nonprofits only -
SHLD3 N-terminal sgRNA
Plasmid#207094PurposepX330 based plasmid for expression of Cas9 and the TTACTGCAGAATGACTACAG sgRNA to target the SHLD3 locus.DepositorInsertTTACTGCAGAATGACTACAG
ExpressionMammalianPromoterCMV and U6Available sinceMay 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
RNF169 C-terminal sgRNA
Plasmid#207099PurposepX330 based plasmid for expression of Cas9 and the ACACTTCATTAGGTGCTACT sgRNA to target the RNF169 locus.DepositorInsertACACTTCATTAGGTGCTACT
ExpressionMammalianPromoterCMV and U6Available sinceMay 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
SHLD1 N-terminal sgRNA
Plasmid#207101PurposepX330 based plasmid for expression of Cas9 and the ATGGCAGGACTATGGCAGCC sgRNA to target the SHLD1 locus.DepositorInsertATGGCAGGACTATGGCAGCC
ExpressionMammalianPromoterCMV and U6Available sinceMay 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
ATM C-terminal sgRNA
Plasmid#207097PurposepX330 based plasmid for expression of Cas9 and the TTTCTAAAGGCTGAATGAAA sgRNA to target the ATM locus.DepositorInsertTTTCTAAAGGCTGAATGAAA
ExpressionMammalianPromoterCMV and U6Available sinceMay 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
SHLD3 KO sgRNA #1
Plasmid#207105PurposepX330 based plasmid for expression of Cas9 and the CGCTATCAAGATTTATACCT sgRNA to target the SHLD3 locus..DepositorInsertCGCTATCAAGATTTATACCT
ExpressionMammalianPromoterCMV and U6Available sinceApril 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
Efg1-ΔDBD
Plasmid#216396PurposeExpresses 6xHis-tagged N- and C-terminal prion-like domains of Efg1DepositorInsertEfg1-ΔDBD
Tags6xHis-tagsExpressionBacterialMutationdeleted amino acids 182-356Available sinceApril 17, 2024AvailabilityAcademic Institutions and Nonprofits only -
Efg1-C-PrLD
Plasmid#216398PurposeExpresses 6xHis-tagged C-terminal prion-like domains of Efg1DepositorInsertEfg1-C-PrLD
Tags6xHis-tagsExpressionBacterialAvailable sinceApril 17, 2024AvailabilityAcademic Institutions and Nonprofits only -
SHLD2 N-terminal sgRNA
Plasmid#207098PurposepX330 based plasmid for expression of Cas9 and the TTTTTATCAGAAATCATGAG sgRNA to target the SHLD2 locus.DepositorInsertTTTTTATCAGAAATCATGAG
ExpressionMammalianPromoterCMV and U6Available sinceApril 10, 2024AvailabilityAcademic Institutions and Nonprofits only -
HaloTag KO sgRNA
Plasmid#207102PurposepX330 based plasmid for expression of Cas9 and the GTCGATGTTGGTCCGCGCGA sgRNA to target the HaloTag coding sequence.DepositorInsertGTCGATGTTGGTCCGCGCGA
ExpressionMammalianPromoterCMV and U6Available sinceMarch 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
MDC1 N-terminal sgRNA
Plasmid#207090PurposepX330 based plasmid for expression of Cas9 and the GTATCCTTCCCAGATCATGG sgRNA to target the MDC1 locus.DepositorInsertGTATCCTTCCCAGATCATGG
ExpressionMammalianPromoterCMV and U6Available sinceMarch 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
SHLD3 KO sgRNA #2
Plasmid#207106PurposepX330 based plasmid for expression of Cas9 and the CTGAAGGAACAGACTAATTC sgRNA to target the SHLD3 locus..DepositorInsertCTGAAGGAACAGACTAATTC
ExpressionMammalianPromoterCMV and U6Available sinceMarch 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
pTST-EGFP-GPIBY55
Plasmid#213706PurposeExpress the affinity sorting tag TST-EGFP- GPIBY55.DepositorInsertEGFP
TagsTwin-strep-tagExpressionMammalianPromoterCMVAvailable sinceFeb. 16, 2024AvailabilityAcademic Institutions and Nonprofits only -
pTST-EGFP-GPICEAM7
Plasmid#213705PurposeExpress the affinity sorting tag TST-EGFP- GPICEAM7.DepositorInsertEGFP
TagsTwin-strep-tagExpressionMammalianPromoterCMVAvailable sinceFeb. 16, 2024AvailabilityAcademic Institutions and Nonprofits only -
pTST-EGFP-GPIDAF
Plasmid#213704PurposeExpress the affinity sorting tag TST-EGFP- GPIDAF.DepositorInsertEGFP
TagsTwin-strep-tagExpressionMammalianPromoterCMVAvailable sinceFeb. 16, 2024AvailabilityAcademic Institutions and Nonprofits only