We narrowed to 6,808 results for: KIT;
-
Plasmid#59570PurposeTC-83 I-SceI T7 5'UTR (A3G) P1234 (nsP2 Q739L) SGP XbaI attB1 Kozak EGFP-PEST ochre attB2 AscI (truncated E1) 3'UTR Poly A I-SceIDepositorInsertSGP XbaI attB1 Kozak EGFP-PEST ochre attB2 AscI
Available SinceAug. 3, 2015AvailabilityAcademic Institutions and Nonprofits only -
pTK194
Plasmid#59563PurposeTC-83 I-SceI T7 5'UTR (A3G) P1234 (nsP2 Q739L) SGP XbaI attB1 Kozak mKate opal attB2 AscI (truncated E1) 3'UTR Poly A I-SceIDepositorInsertSGP XbaI attB1 Kozak mKate opal attB2 AscI
Available SinceAug. 3, 2015AvailabilityAcademic Institutions and Nonprofits only -
pMS114
Plasmid#215677PurposeEmpty repair plasmid for ChrI split hygromycinR landing padDepositorInsert5'HA + MCS + loxN + rps-0p::5'ΔHygR
UseCRISPR and Cre/LoxExpressionWormMutation5' ∆HYGR encodes aa1-226Available SinceMarch 21, 2024AvailabilityAcademic Institutions and Nonprofits only -
pJRA107
Plasmid#209340PurposeGateway cloning compatible binary vector for agrobacterium mediated transformation. Arabidopsis UBQ10 promoter expression of N-terminal mNeonGreen fusion protein.DepositorTypeEmpty backboneExpressionPlantAvailable SinceJan. 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLYS5-SDHB-Flag
Plasmid#50055PurposeExpression of human SDHB in mammalian cellsDepositorAvailable SinceJan. 13, 2014AvailabilityAcademic Institutions and Nonprofits only -
pMS59
Plasmid#215680PurposeCas9 + guide plasmid targeting ChrI split hygromycinR landing padDepositorInserteef-1A.1p::Cas9 + U6p::GTTTGAGTAGAGCACTCAGG
UseCRISPRExpressionWormAvailable SinceMarch 21, 2024AvailabilityAcademic Institutions and Nonprofits only -
MAC_C_EPHB4
Plasmid#187768PurposeMAC-tagged gene expression of human EPHB4DepositorInsertEPHB4 (EPHB4 Human)
ExpressionMammalianAvailable SinceAug. 30, 2022AvailabilityAcademic Institutions and Nonprofits only -
MTK0_002
Plasmid#123960PurposeEncodes the piggyBac GFP dropout destination vector with the 2xHS4 insulator as a type 0 part to be used in the MTK systemDepositorInsertPB Destination - 2xHS4 - HygroR
ExpressionMammalianAvailable SinceDec. 13, 2019AvailabilityAcademic Institutions and Nonprofits only -
mc2 blast hPGK
Plasmid#206229PurposeFor expressing cloned exons as circular RNA. Alternatively, for expressing cDNA (if the EcoRI-XhoI restriction fragment is also removed).DepositorTypeEmpty backboneUseSynthetic BiologyExpressionMammalianAvailable SinceSept. 1, 2023AvailabilityAcademic Institutions and Nonprofits only -
GFP-mZO-1(9-1745)-Myc-His
Plasmid#236529PurposeFor expression of ZO-1 (9-1745 aa, mouse)-Myc-His alpha+ in mammalian cellsDepositorAvailable SinceApril 16, 2025AvailabilityAcademic Institutions and Nonprofits only