We narrowed to 16,006 results for: grna
-
-
-
-
-
-
-
-
gh42
Plasmid#106716Purposeexpression of gRNA targeting ST6GALNAC1DepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertST6GALNAC1 (ST6GALNAC1 Human)
ExpressionMammalianAvailable sinceNov. 9, 2018AvailabilityAcademic Institutions and Nonprofits only -
-
-
gh45
Plasmid#106708Purposeexpression of gRNA targeting ST6GALNAC4DepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertST6GALNAC4 (ST6GALNAC4 Human)
ExpressionMammalianAvailable sinceNov. 9, 2018AvailabilityAcademic Institutions and Nonprofits only -
-
-
-
p35C-epegRNA-ccdB
Plasmid#246791PurposeExpress pegRNA in plant cells (protoplast or callus) for prime editingDepositorInsertccdB
UseCRISPRAvailable sinceMarch 17, 2026AvailabilityAcademic Institutions and Nonprofits only -
pHelper-CBE-sgRNA
Plasmid#221137PurposeHelper plasmid for sgRNA cloning for CRISPR-Cas9 cytosine base editing. sgRNA-scaffold with Cas9 handle expressed from constitutive bacterial promoter J23119(SpeI). 2 BbsI sites for sgRNA cloning.DepositorInsertsgRNA-scaffold with Cas9 handle
UseCRISPRExpressionBacterialPromoterJ23119(SpeI)Available sinceNov. 19, 2024AvailabilityAcademic Institutions and Nonprofits only -
LentiCRISPRv2 EGFP sgRNA2
Plasmid#164933PurposeExpresses EGFP sgRNA2 in mammalian cellsDepositorInsertsgRNA2 targeting Enhanced green fluorescent protein (verified for knockout)
UseLentiviralPromoterEFS promoterAvailable sinceJuly 19, 2024AvailabilityAcademic Institutions and Nonprofits only -
53BP1 N-terminal sgRNA
Plasmid#207091PurposepX330 based plasmid for expression of Cas9 and the GGGGAGCAGATGGACCCTAC sgRNA to target the 53BP1 locus.DepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertGGGGAGCAGATGGACCCTAC
ExpressionMammalianPromoterCMV and U6Available sinceMarch 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
lentiCherry U6-sgRNA (BsmBI)
Plasmid#214128PurposeMammalian continuous expressionDepositorInsertsgRNA
UseLentiviralExpressionMammalianMutationWTAvailable sinceFeb. 27, 2024AvailabilityAcademic Institutions and Nonprofits only -
pShoCAST-sgRNA_entry (BO1)
Plasmid#181786PurposeExpresses ShoCAST. New sgRNA spacer sequences can be added using Golden Gate assembly (via SapI sites).DepositorInsertShoTnsB, ShoTnsC, ShoTniQ, ShoCas12k
ExpressionBacterialPromoterLac and J23119Available sinceMarch 31, 2022AvailabilityAcademic Institutions and Nonprofits only
