We narrowed to 39,344 results for: NAM
-
Plasmid#188740PurposeExpresses mTurqoise2 for N-terminal taggingDepositorInsertgdpA-mTurqoise2 PtrA
UseFilamentous fungal expressionTagsmGreenlanternAvailable SinceNov. 18, 2024AvailabilityAcademic Institutions and Nonprofits only -
pJB50
Plasmid#226311PurposeE. coli and H. neapolitanus shuttle vector; integrates the gene of interest and a kanamycin resistance marker into a neutral site on the H. neapolitanus genome.DepositorInsertCsoS2 with V(T/S)G to AAA CsoS2 MR1-7
ExpressionBacterialMutationVTG273-5AAA, VTG284-6AAA, VTG295-7AAA, VSG332-4AA…PromoterpTRCAvailable SinceOct. 21, 2024AvailabilityAcademic Institutions and Nonprofits only -
pJB55
Plasmid#226310PurposeE. coli and H. neapolitanus shuttle vector; integrates the gene of interest and a kanamycin resistance marker into a neutral site on the H. neapolitanus genome.DepositorInsertCsoS2 with V(T/S)G to AAA CsoS2 MR1-5
ExpressionBacterialMutationVTG273-5AAA, VTG284-6AAA, VTG295-7AAA, VSG332-4AA…PromoterpTRCAvailable SinceOct. 21, 2024AvailabilityAcademic Institutions and Nonprofits only -
Tol2-U6.3-sgRNA-non-targeting-control -GFP
Plasmid#221844PurposeTol2 transposon expresses control non-targeting sgRNA from chick U6.3 promoter expresses GFP reporter from GAGC promoterDepositorInsertsEGFP
non-targeting control sgRNA- GCACTGCTACGATCTACACC
UseCRISPR; Tol2 transposon optimised for chick expre…ExpressionMammalianPromoterGACG and U6.3 chickAvailable SinceJuly 31, 2024AvailabilityAcademic Institutions and Nonprofits only -
pETSUMO2_Ideonella-bGSDM-WELQ
Plasmid#222098PurposeFor expression of a mutant bacterial gasdermin (bGSDM) encoded by a Ideonella species with a WELQut protease cleavage site for controlled activation.DepositorInsertIdeonella-bGSDM-WELQ ORF
Tags6xHis-SUMO2ExpressionBacterialMutationN-terminal methionine deleted and replaced by sin…PromoterT7Available SinceJuly 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
pMamCol1
Plasmid#215184PurposeAllows for stable expression of recombinant (tagged/untagged) proteins in AAVS1 locus of Human cells and transient Protein Expression in E. coliDepositorInserttsPurple
UseAAV, CRISPR, and Synthetic Biology ; Recombinant …TagsSNAC-StrepII tagExpressionBacterial and MammalianPromoterTetON 3G Bidirectional for Mammalian and Trc with…Available SinceApril 19, 2024AvailabilityAcademic Institutions and Nonprofits only -
pMx/ATP10A(E203Q)-HA
Plasmid#209258PurposeMammalian expression of ATP10A mutant E203QDepositorAvailable SinceNov. 3, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCAG/ATP10A(E203Q)-HA
Plasmid#209246PurposeMammalian expression of ATP10A mutant E203QDepositorAvailable SinceNov. 3, 2023AvailabilityAcademic Institutions and Nonprofits only -
pBAD-R-iLACCO1.2
Plasmid#208021PurposeBiosensor for intracellular L-lactateDepositorInsertR-iLACCO1.2
ExpressionBacterialAvailable SinceOct. 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pBAD-R-diLACCO1
Plasmid#208022PurposeControl biosensor for intracellular L-lactateDepositorInsertR-diLACCO1
ExpressionBacterialAvailable SinceOct. 30, 2023AvailabilityAcademic Institutions and Nonprofits only