We narrowed to 10,162 results for: tre promoter
-
Plasmid#221820PurposePlasmid to express gRNA (gaccagtccactaccgcagc) for editing at the end of Drosophila 5-HT1AR coding frameDepositorAvailable SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only
-
pdU6-2_sgRNA1-d5-HT1BR
Plasmid#221821PurposePlasmid to express gRNA1 (gaaaatttgatttcaactga) for editing at the end of Drosophila 5-HT1BR coding frameDepositorInsertd5-HT1BR gRNA1 (5-HT1B Fly)
UseCRISPRExpressionInsectPromoterzebrafish U6 promoter (U6b)Available SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pdU6-2_sgRNA2-5-HT1BR
Plasmid#221822PurposePlasmid to express gRNA2 (aatttcgacgggccttcaag) for editing at the end of Drosophila 5-HT1BR coding frameDepositorAvailable SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pdU6-2_sgRNA1-5-HT2AR-isoformD
Plasmid#221823PurposePlasmid to express gRNA1 (tccttctggcgcaaacacgg) for editing at the end of Drosophila 5-HT2AR isoform D coding frameDepositorInsertd5-HT2AR isoform D gRNA1 (5-HT2 Fly)
UseCRISPRExpressionInsectPromoterDrosophila U6 promoterAvailable SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pdU6-2_sgRNA2-5-HT2AR-isoformD
Plasmid#221824PurposePlasmid to express gRNA2 (ctgaagacataattacgtgg) for editing at the end of Drosophila 5-HT2AR isoform D coding frameDepositorInsertd5-HT2AR isoform D gRNA2 (5-HT2 Fly)
UseCRISPRExpressionInsectPromoterzebrafish U6 promoter (U6b)Available SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pdU6-2_sgRNA1-5-HT2AR-isoformBFH
Plasmid#221825PurposePlasmid to express gRNA1 (cgctatcggtctgtgacaga) for editing at the end of Drosophila 5-HT2AR isoforms B, F and H coding frameDepositorInsertd5-HT2AR isoforms BFH gRNA1 (5-HT2 Fly)
UseCRISPRExpressionInsectPromoterzebrafish U6 promoter (U6b)Available SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pdU6-2_sgRNA2-5-HT2AR-isoformBFH
Plasmid#221826PurposePlasmid to express gRNA2 (ggaaaagccgctaattacag) for editing at the end of Drosophila 5-HT2AR isoforms B, F and H coding frameDepositorInsertd5-HT2AR isoforms BFH gRNA2 (5-HT2 Fly)
UseCRISPRExpressionInsectPromoterDrosophila U6 promoterAvailable SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pdU6-2_sgRNA-d5-HT7R
Plasmid#221829PurposePlasmid to express gRNA (ggcgagggagagctttctct) for editing at the end of Drosophila 5-HT1AR coding frameDepositorAvailable SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
mC4-GFP
Plasmid#221339PurposeExpresses murine homolog of complement 4 fused with GFP under CAG promoterDepositorAvailable SinceAug. 13, 2025AvailabilityAcademic Institutions and Nonprofits only -
pRS313_MSN5-LY00018
Plasmid#232903PurposePlasmid carrying MSN5 from LY00018 (YJM975) with its native promoter and terminator.DepositorAvailable SinceFeb. 26, 2025AvailabilityAcademic Institutions and Nonprofits only -
pRS313-rad53-5004
Plasmid#232902PurposePlasmid carrying the rad53-5004 allele with its native promoter and terminator.DepositorAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCMV-eA3A-BE5-(NG)-PX458-EGFP
Plasmid#229687PurposeCRISPR CBE plasmid (C to T edits): eA3A-BE5-NG engineered to include the sgRNA cloning backbone from PX458 and EGFP. Includes BbsI sites for sgRNA cloning downstream of U6 promoter.DepositorTypeEmpty backboneUseCRISPRTagsEGFPExpressionMammalianAvailable SinceJan. 23, 2025AvailabilityAcademic Institutions and Nonprofits only -
-
pCAG-RhoA*
Plasmid#198716PurposeExpresses gRNA resistant RhoA under the CAG promoter in mammalian cellsDepositorInsertRhoA (Rhoa Mouse)
ExpressionMammalianMutationIt has mutations that is resistant to the RhoA gR…PromoterCAGAvailable SinceDec. 11, 2024AvailabilityAcademic Institutions and Nonprofits only -
pSG086
Plasmid#214263PurposePaFtsH2H1-link-32-6xHis: PaftsH2(ftsH2_F124-V154del_ins ftsH1_M120-T151)-6xHis cloned in XbaI/NheI site in pET-28a(+)DepositorInsertHybrid PaFtsH protease PaFtsH2H1-link-32 of Pseudomonas aeruginosa SG17M
Tags6x His-tagExpressionBacterialMutationsubstitution of 31 amino acids of FtsH2 (F124RRFA…PromoterT7 promoterAvailable SinceOct. 4, 2024AvailabilityAcademic Institutions and Nonprofits only -
pMtnA FLAG-IntS7 puro
Plasmid#208405PurposeExpresses FLAG-tagged Drosophila IntS7 from inducible MtnA promoterDepositorAvailable SinceDec. 8, 2023AvailabilityAcademic Institutions and Nonprofits only -
pMtnA FLAG-IntS13 puro
Plasmid#208406PurposeExpresses FLAG-tagged Drosophila IntS13 from inducible MtnA promoterDepositorAvailable SinceDec. 8, 2023AvailabilityAcademic Institutions and Nonprofits only -
pMtnA FLAG-IntS14 puro
Plasmid#208407PurposeExpresses FLAG-tagged Drosophila IntS14 from inducible MtnA promoterDepositorAvailable SinceDec. 8, 2023AvailabilityAcademic Institutions and Nonprofits only -
pMtnA FLAG-IntS6 puro
Plasmid#195076PurposeExpresses FLAG-tagged Drosophila IntS6 from inducible MtnA promoterDepositorAvailable SinceNov. 29, 2023AvailabilityAcademic Institutions and Nonprofits only -
pMtnA FLAG-IntS12 puro
Plasmid#195077PurposeExpresses FLAG-tagged Drosophila IntS12 from inducible MtnA promoterDepositorAvailable SinceNov. 29, 2023AvailabilityAcademic Institutions and Nonprofits only